• Sonuç bulunamadı

3. BÖLÜM ANLAMLI İŞ

3.2. Anlamlı İş Kavramı

Dans cette étude nous avons tenté de préciser l’implication de la sphingomyéline synthase dans la signalisation cytotoxique de Fas dans les lymphocytes T, dépendante et indépendante de l’activité catalytique des caspases. La synthèse de novo de sphingomyéline et l’activité de la SMS ont été mesurées dans des cellules Jurkat et des PBL, incubés ou non, en présence de FasL. Pour préciser les mécanismes moléculaires, l’effet de la déficience en caspase-8, du z-VAD ou de la surexpression de Bcl-xL a été testé sur l’activité de la SMS. Pour évaluer le rôle de la SMS dans la signalisation cytotoxique de Fas nous avons testé : (i) l’effet du D609, un inhibiteur de la SMS (Huitema et al., 2004; Luberto and Hannun, 1998), sur la synthèse de SM et la mort de cellules Jurkat et de PBL en réponse à FasL ; (ii) la sensibilité à FasL de cellules Jurkat exprimant de façon stable un siRNA dirigé contre la SMS1.

ARTICLE 3

Milhas, D., Benoist, H., Garcia, V., Zhe-Xiong, J., Umehara, H., Okazaki, T., Levade, T. and Segui, B. FasL-triggered inhibition of sphingomyelin synthesis is involved in ceramide increase and caspase-dependent and -independent cell death in human activated and leukemia T cells. (en préparation).

FasL-triggered inhibition of sphingomyelin synthesis is involved in ceramide

increase and caspase-dependent and -independent cell death in human

activated and leukemia T cells.

Delphine Milhas1, Hervé Benoist1, Virginie Garcia1, Zhe-Xiong Jin2, Hisanori Umehara2, Toshiro Okazaki3, Thierry Levade1, and Bruno Ségui1

1Inserm U858, Institut de Médecine Moléculaire de Rangueil, BP 84225, 31432

Toulouse Cédex 4, France.

2Division of Hematology and Immunology, Department of Internal Medicine,

Kanazawa Medical University, Ishikawa 920-0293, Japan.

3Department of Clinical Laboratory, Medicine/Hematology, Faculty of Medicine,

Tottori University, Yonago, Tottori 683-8504, Japan.

Corresponding author: Bruno Ségui, Inserm U858, Institut de Médecine Moléculaire de Rangueil, BP 84225 31432 Toulouse Cédex 4, France.

[email protected], (33)5 61 32 20 60, Fax (33)5 61 32 20 84

Running title: Sphingomyelin synthesis in Fas signaling

Keywords: lymphocyte, CD95, sphingomyelin synthase, sphingolipids, apoptosis, necrosis.

Abstract word count: 197; Total text word count: (excluding title page, abstract, figure legends and references): 4355; Number of references: 47.

Abstract

Ceramide is converted to sphingomyelin (SM) by SM synthase (SMS). Herein, we show that in human leukemia Jurkat cells, FasL treatment inhibited SMS activity in a dose- and time-dependent manner. SMS inhibition elicited by low FasL concentrations (10–50 ng/mL) was abrogated by zVAD-fmk, a broad-spectrum caspase inhibitor, and did not occur in caspase-8-deficient cells. When a higher FasL concentration (500 ng/mL) was used, SMS inhibition was only partially blocked by zVAD-fmk and caspase-8 deficiency. Thus, FasL-mediated SMS inhibition depends mainly on caspase activation but can also occur in a caspase-independent manner. A non-toxic concentration (50 µg/mL) of the tricyclodecan-9-yl xanthogenate D609 inhibited SMS activity and transiently increased ceramide level. D609 significantly enhanced FasL-induced caspase activation and apoptosis and partially overcame zVAD-fmk- and caspase-8-deficiency-conferred resistance to FasL. In activated human T lymphocytes, FasL triggered SMS inhibition, and D609 enhanced FasL- induced cell death in the presence or absence of zVAD-fmk. FasL-induced caspase- dependent and -independent ceramide production and cell death were enhanced in Jurkat cells stably over-expressing siRNA against SMS1. Altogether, our data indicate that the inhibition of ceramide conversion to SM is accompanied by an enhancement of FasL-induced caspase-dependent and -independent cell death in T lymphocytes.

Introduction

Fas (CD95) engagement by FasL (CD95L or CD178) plays a crucial function in the regulation of T cell homeostasis, essentially through cell death induction in activated- T cells 1. FasL-induced T cell death is viewed as an essential negative regulatory mechanism of T cell activation, limiting T cell response in immune responses and autoimmune diseases. In humans, gene mutations affecting either FasL, Fas or Fas signaling proteins such as initiator caspases are responsible for ALPS (Autoimmune lymphoproliferative syndrome) 2.

Scaffidi and co-workers reported the existence of two different cell types as defined by distinct Fas signaling routes 3. Type 1 cells were originally defined by their capacity to form large amounts of death-inducing signaling complex (DISC) consisting in the recruitment of the adaptor protein FADD and initiator caspases to the Fas receptor upon activation. This enables strong and direct activation of the caspase cascade independently of mitochondrial events. In type 2 cells, such as Jurkat T leukemia cells, DISC formation occurs less efficiently than in type 1 cells. Both initiator caspases, i.e., caspase-8 and -10, are activated at the DISC level 4-6 and cleave Bid 7-10, allowing cytochrome c release from the mitochondria 7,8, which is a critical event for FasL-induced caspase activation and apoptosis 3. It has been recently reported that internalization of the Fas receptor is required for efficient DISC formation and apoptosis induction in type 1 cells but not in type 2 cells 11. Fas stimulation has also been reported to activate a caspase-independent pathway involving the serine/threonine kinase RIP1 (Receptor Interacting Protein) as an effector molecule 12. The signaling pathway activated by RIP is largely unknown and likely involves ROS production, and leads to a necrotic form of cell death rather than apoptosis 12.

A growing body of evidence supports the involvement of ceramide, a sphingolipid bioactive molecule, or its metabolites in stress-induced caspase-dependent and - independent cell death (for a recent review, see 13). This ceramide-induced cell death is inhibited by over-expression of Bcl-2 or Bcl-xL, suggesting the involvement of mitochondrial events 13. Ceramide has been recently proposed as a mediator in TNF- induced caspase-independent cell death in various cell lines 14. In this context, ceramide production involved RIP1 14. Ceramide can be generated by sphingomyelin (SM) breakdown as a consequence of sphingomyelinase (SMase) activation and/or increase of de novo synthesis. Ceramide is synthesized within the endoplasmic reticulum and converted in the Golgi to SM and glucosylceramide (GlcCer) by SMS and GlcCer synthase (GCS), respectively. Both enzymes are capable of negatively regulating intracellular ceramide concentrations and are inhibited upon various stress conditions, which trigger ceramide increase and cell death 13. Tepper and co-workers previously reported that GCS does not regulate ceramide generated upon Fas cross- linking 15. A more recent study indicates that Fas engagement is accompanied by the inhibition of a SMS activity and ceramide increase within the nucleus 16.

Two different genes encoding SMS have been cloned so far 17,18. The corresponding proteins, SMS1 and SMS2, are mainly localized at the Golgi and at the plasma membrane, respectively 17. Members of the SMS family include four different splice variants of the mouse SMS1 gene 19. Recently, SMS1 has been identified by screening a mouse T-cell cDNA library in Saccharomyces cerevisiae as a suppressor of the growth inhibitory effect of Bax and other cytotoxic stimuli including hydrogen

line deficient in SMS, and over-expression of SMS1 restored full caspase activation and cell death 21. Thus, a robust and sustained inhibition of SMS might alter membrane composition and properties through SM depletion and confer cell death resistance 13.

D609, a xanthate compound with anti-viral, anti-tumor and anti-inflammatory properties 22-25, has been reported to inhibit phosphatidylcholine (PC) phospholipase C (that awaits molecular identification) and SMS 16,17,26,27. Both SMS1 and SMS2 can be inhibited by D609, the extent of inhibition for SMS1 being greater than for SMS2

17. Controversy exists as to the effect of D609 in Fas signaling. D609 enhances Fas

cross-linking-induced ceramide production and cell death in human leukemia cells

16,28. More recently, it has been published that D609 impaired HeLa cell death in

response to an agonistic anti-Fas antibody whereas it had no effect in SKW6.4 cells

29. Thus, one could speculate that the ability of D609 to modulate death receptor-

induced cell death is cell type-dependent. However, it should be noted that conflicting findings were reported using the same cell type, i.e., Jurkat cells, in response to Fas engagement 16,29.

The present study aimed at investigating the function of SM biosynthesis in modulating FasL-induced cell death in T lymphocytes and leukemia cells. Our data underscore the importance of SMS inhibition in FasL-triggered ceramide increase and cell death.

Materials and Methods

Reagents

Final concentrations or dilutions and the source of reagents were as follows: D609 (50 µg/mL) was obtained from Sigma (Saint Quentin Fallavier, France); zVAD(OMe)-fmk (40 µM) was purchased from Bachem (Voisins-Le-Bretonneux, France); polyclonal anti-caspase-3 (10 µg/ml) was obtained from Dako (Trappes, France); monoclonal anti-caspase-8 (clone 1C12) and polyclonal anti-PARP were purchased from Cell Signaling Technology (Saint-Quentin-en-Yvelines, France) and used at 1/1000 dilution; monoclonal anti-β-actin (clone AC-15; 5 µg/ml) was from Sigma; monoclonal anti-Bcl-xL (clone 2H12, 1 µg/mL) was from BD Biosciences (Le Pont-De-Claix, France).

Human recombinant FasL was obtained from Abcys (Paris, France). Alternatively, mouse FasL produced in the supernatant of Neuro-2A cells stably transfected with a plasmid encoding FasL 30 was used. Similar data were obtained with mouse and human FasL.

Cell lines

Parental Jurkat T leukemia cells (clone A3) and derived cell lines deficient for caspase-8 (clone I9-2) 31 were kindly provided by Dr. J. Blenis (Boston, MA). Mock transfected Jurkat cells (clone E6) and Bcl-xL over-expressing E6 cells were a kind gift from Dr. C. Thompson (Chicago, IL) 32. Jurkat cells were transduced by a retroviral vector encoding either a scrambled (ATTGAAAAAGACACGCGCC) or human SMS1 siRNA (GCCCAACTGCGAAGAATAA) to obtain stable transfectants

Human peripheral blood lymphocytes (PBL) were obtained from healthy donors after separation from heparinized venous blood by centrifugation (700 x g, 20 min) over Ficoll (Gibco, Cergy-Pontoise, France). Allowing cell adhesion to the flask for 4 hours eliminated adherent cells. The remaining cells (i.e., PBL) were cultured for 6 days with 1 µg/mL phytohemagglutinin (PHA) (Sigma) in the presence of 20 U/mL IL-2 (a kind gift from Sanofi Aventis, Toulouse, France). Cells were cultured in RPMI 1640 medium containing Glutamax and 10% heat-inactivated fetal calf serum (FCS) (Gibco, France).

Analysis of mRNA expression

Total RNA was isolated from Jurkat cells using QIAGEN RNeasy kit (Qiagen, France) and reverse transcribed using oligo(dT)15 (Promega, France) and

Superscript II (Invitrogen, France), as recommended by the manufacturers. cDNA were analyzed by quantitative real time polymerase chain reaction (PCR) using specific primers for SMS1, SMS2 and GAPDH (Qiagen) and Power SYBR Green PCR Master mix (Applied biosystems, France). Mixtures were loaded in a Taqman 7900 (Applied biosystems) and amplification was performed according to the manufacturer’s instructions. Alternatively, cDNA were amplified by 30 PCR cycles using GoTaq Flexi DNA Polymerase (Promega) and specific primers for SMS1

(forward primer: CATTTCAACTGTTCTCCGAAGC; reverse primer:

CCATAGTGTGATACCACCAG), SMS2 (forward primer:

TTAATCTGCTGGCTGCTGAG; reverse primer: ACCAATCTTCTGAACCCGTG) and GAPDH (forward primer: AACATCATCCCTGCCTCTACTG; reverse primer: TTGACAAAGTGGTCGTTGAGG). cDNA prepared from human skin fibroblasts and vectors carrying human cDNA for SMS1 and SMS2 were used as positive controls. Amplifications were performed in a thermal cycler (Biorad) and amplification products

were analyzed after migration into a 0.8% agarose gel and ethidium bromide staining.

Flow cytometry analyses

Phosphatidylserine (PS) externalization was evaluated by labeling cells with Annexin V-FITC (250 ng/ml) and propidium iodide (12.5 µg/ml) (Immunotech, Marseille, France) for 10 min at 4°C. Hypodiploidy was detected by washing cells in PBS and permeabilization in 70% ethanol for 10 min at –20°C. Cells were next incubated for 30 min at 37°C with RNase (1 µg/ml) and propidium iodide (0.1 mg/ml). Percentage of hypodiploid cells carrying a DNA content below that of cells in G0/G1 was quantified by flow cytometry. Analyses were performed on a FACScan cytometer (Becton Dickinson, Le-Pont-de-Claix, France) 9.

Protein extraction and Western blotting analyses

For total protein extraction, 5 x 106 cells were lysed for 30 min on ice in a buffer containing 50 mM HEPES, pH 7.5, 150 mM NaCl, 10 % glycerol, 1% Triton X- 100, 0.5% deoxycholate, 1 mM NaVO4, 10 µM β-glycerophosphate, 50 mM NaF, 1

mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 2 µg/ml pepstatin A and 10 µg/ml aprotinin. Samples were centrifuged at 3,500 x g at 4°C for 10 min. Supernatants were collected and protein content was determined by the Bradford method (Biorad). For Western blot analyses, equal amounts of proteins were separated on 12.5% SDS-PAGE.

Determination of SMS and GCS activities

lower phases were dried under nitrogen and resolved by analytical thin layer chromatography (TLC) developed in chloroform/methanol/30% ammonia (70:30:5, by vol.). C6-NBD-ceramide, C6-NBD-GlcCer and C6-NBD-SM were eluted from the silica

and quantified spectrofluorometrically (λex=470 nm and λem=530 nm) 34. Ceramide and Diacylglycerol (DAG) mass measurement

Lipids were extracted as described above. Ceramide mass was determined as previously reported 35 using E. coli membranes as a source of DAG kinase (a kind gift of Drs. D. Perry and Y.A. Hannun (Charleston, NC)). Radioactive ceramide-1-

phosphate and phosphatidic acid were isolated by TLC using

chloroform/acetone/methanol/acetic acid/water (50:20:15:10:5, by vol.) and then scraped before counting radioactivity by liquid scintillation.

Quantification of sphingolipids

3x106 cells were incubated for 48-72 hours in the presence of 0.33 µCi/mL [3H]sphingosine (PerkinElmer, France) to label sphingolipids to the equilibrium. Lipids were extracted and separated by TLC using chloroform/methanol/water (100:42:6, by

vol.). Radiolabeled sphingolipids were detected using a Berthold

radiochromatoscanner, identified using lipid standards and then scraped before counting radioactivity by liquid scintillation. Alternatively, 3x106 cells were incubated for 48-72 hours in the presence of 1 µCi/mL [3H]choline (PerkinElmer, France) to label SM and PC to the equilibrium. The extracted SM and PC were separated by alkaline hydrolysis as previously described 36.

De novo SM synthesis

3x106 cells were incubated in the presence of [3H]choline (1 µCi/mL) for 4 hours to allow PC labeling and further incubated for the indicated times in the presence or absence of FasL. Then, cells were sedimented at 4°C by low-speed

centrifugation, and cell pellets were immediately frozen at -20°C. [3H]choline-labeled SM was next quantified after alkaline methanolysis as previously described 36.

Morphological analysis

Cells were half-diluted in a trypan blue dye solution (0.4% in PBS) for 5 min and analyzed under a Leica light microscope. At least 300 cells were examined and the percentage of cells exhibiting apoptotic nuclei (i.e., condensed and/or fragmented nuclei) was determined. The percentage of trypan blue positive cells did not increase during the first 4 hours of incubation with FasL.

Statistical analysis

Results are expressed as means ± s.e.m. of at least three values per experiment. Mean values were compared using the Student’s t-test. Differences were considered statistically significant when p<0.05 (as indicated by an asterisk on the figures; n.s. : not significant).

RESULTS

FasL triggered inhibition of de novo SM synthesis.

In Jurkat cells, SM represents the most abundant sphingolipid (approximately 70% of total sphingolipids) whereas ceramide content averages 8% (Fig. 1A). Upon FasL, sphingolipid pattern was profoundly perturbed (Fig. 1A). Notably, ceramide content strongly increased in a time-dependent manner up to 20%, concomitantly to SM decrease and cell death induction (Figs. 1B and 1C). In sharp contrast, no or little variation was observed for the cellular content of GlcCer and lactosylceramide (LacCer) (Fig. 1B). SM decrease and ceramide increase were likely a consequence of SMase activation since FasL has been reported to activate both neutral and acidic SMases 37. We hypothesized that an inhibition of SM synthesis may also account for the observed changes in sphingolipid levels. Accordingly, FasL induced a sustained and substantial inhibition of SM synthesis as early as one hour, and SM synthesis was almost completely impaired after 4-hour FasL treatment (Fig. 1D). We next measured in situ SMS and GCS activities by monitoring in intact cells the conversion of a fluorescent analog of ceramide into SM and GlcCer. In Jurkat cells, SMS activity was inhibited upon FasL in a time and dose-dependent manner whereas GCS remained essentially unaffected, except at late time points and at the highest FasL concentration (Figs. 2A and 2B). 500 ng/mL FasL also triggered the inhibition of SMS and GCS activities in activated human PBL (Fig. 2A). FasL-induced GCS inhibition was prevented by zVAD-fmk, a broad-spectrum caspase inhibitor, and did not occur in caspase-8-deficient cells indicating caspase involvement (Fig. 2B right). SMS inhibition mediated by low FasL concentrations (10 – 50 ng/mL) was also abrogated by zVAD-fmk and caspase-8 deficiency (Fig. 2B left). When a higher FasL concentration (500 ng/mL) was used, SMS inhibition was only partially blocked by

zVAD-fmk (Fig. 2B left) whereas FasL-induced caspase activation, as evaluated by measuring specific activities towards DEVD-AMC and IETD-AMC peptides, was completely inhibited (data not shown). Also, SMS inhibition elicited by 500 ng/mL FasL occurred, to some extent, in caspase-8-deficient cells (Fig. 2B). Thus, FasL- mediated SMS inhibition depends mainly on caspase activation but can also occur in a caspase-independent manner. To further delineate molecular events involved in SMS inhibition, we evaluated the impact of Bcl-xL over-expression. Whereas Bcl-xL over-expression significantly impaired cell death (data not shown), it did not prevent SMS inhibition to all doses of FasL (Fig. 2C). Thus, FasL-mediated SMS inhibition occurred chiefly downstream of caspase-8 activation and upstream of mitochondrial events.

D609 inhibits SMS and stimulates FasL-induced caspase-dependent and -

independent cell death in Jurkat and in activated T cells.

D609 has been previously shown to inhibit SMS activity in SV40-transformed fibroblasts and leukemia cells 16,17,26,27. A non-toxic concentration of D609 (50 µg/mL) significantly inhibited SMS but not GCS in Jurkat cells (Fig. 3A). Also, endogenous ceramide content transiently increased with a peak at 2 to 3 hours post-treatment and returned to control values at 8 hours (Fig. 3A and data not shown). In response to a low FasL concentration (10 ng/mL), caspase activation was increased by D609 as evaluated by Western blot using anti-caspase-3 and anti-PARP antibodies (Fig. 3B). Accordingly, D609 significantly enhanced FasL-induced PS externalization (Fig.

to FasL indicating that D609 overcomes, to some extent, caspase-8 deficiency (Fig. 3C). We next evaluated the effect of D609 in FasL-induced cell death in the presence of zVAD-fmk. The addition of D609 not only significantly sensitized Jurkat cell death induced by a high FasL concentration (500 ng/mL) but also by-passed zVAD-fmk- mediated resistance towards FasL concentration as low as 50 ng/mL (Fig. 3D). This phenomenon was associated to an enhancement of ceramide increase by D609 (Fig. 3D). Whereas FasL alone triggered apoptosis as evidenced by nuclear fragmentation, FasL-induced cell death was associated with some necrotic features (i.e., marginal chromatin condensation and membrane permeability increase) when cells were incubated with zVAD-fmk in the presence or absence of D609 (data not shown).

Similarly to Jurkat cells, 50 µg/mL D609 significantly inhibited SMS but not GCS in activated T lymphocytes (Fig. 4A). FasL-induced cell death, as evaluated by the increase of hypodiploid cells (Fig. 4B) and PS externalization (Fig. 4C), was stimulated by D609. Whereas zVAD-fmk completely abrogated cell death in response to FasL, D609 restored FasL-induced toxicity and, thus, overcame caspase inhibition-induced resistance of T lymphocytes.

SMS1 knockdown enhances FasL-induced caspase-dependent and -

independent cell death in Jurkat cells.

The expression of SMS1 and SMS2 was evaluated by quantitative real time PCR in Jurkat cells. Cycle threshold (Ct) values for SMS1 and SMS2 were 24.6 ± 0.3 and 29.7 ± 0.7 (mean ± s.e.m., n=3), respectively, suggesting that SMS1 was likely the most expressed SMS isoform in Jurkat cells. Similar findings were recently reported in S49, a murine lymphoma cell line 38. Also, analytical RT-PCR showed SMS1 but no SMS2 mRNA in Jurkat cells whereas human skin fibroblasts expressed both

isoforms (Fig. 5A). Jurkat cell lines stably over-expressing siRNA against SMS1 were then established. Expression of SMS1 mRNA in SMS1 knockdown (KD) Jurkat variant (SMS1 KD Jurkat cells) was reduced by approximately 40% as evaluated by quantitative real time PCR (Jin Z.X., Okazaki T., Umehara H., submitted) and analytical RT-PCR (Fig. 5A) as compared to Jurkat cells stably transfected with scrambled siRNA (control Jurkat cells). SMS1 KD Jurkat cells displayed about 40% reduction in SMS activity but normal GCS activity as compared to control Jurkat cells (Fig. 5B). Noteworthy, the two variants displayed similar expression of Fas, FADD, caspase-8, -3 and -7, PARP and RIP, as evaluated by flow cytometry and Western blotting (data not shown). Because SMS activity is known to putatively participate in the homeostasis of SM, PC, ceramide and DAG, we evaluated the intracellular levels of these different lipids in control and SMS1 KD Jurkat cells. Whereas SMS1 KD Jurkat cells displayed less SM and more PC (Fig. 5C), no significant differences were observed for ceramide and DAG contents (Fig. 5D). Also, basal levels of GlcCer and LacCer were increased by 171±29% and 145±21% (mean ± s.e.m., n=3), respectively, in SMS1 KD Jurkat cells as compared to control cells. Upon FasL, whereas no or little variation was observed for DAG (Fig. 5D), GlcCer and LacCer (data not shown), ceramide increase (Figs. 5D and 5E) and SM decrease (Fig. 5E) were enhanced in SMS1 KD Jurkat cells as compared to control counterparts.

SMS1 KD Jurkat cells and control cells were analyzed to further evaluate the importance of SMS inhibition in FasL-induced cell death. Whereas the two variants