• Sonuç bulunamadı

A Rare β°-Thalassemia Frameshift Mutation in a Turkish Individual: (+T) at Codon 9/10

N/A
N/A
Protected

Academic year: 2021

Share "A Rare β°-Thalassemia Frameshift Mutation in a Turkish Individual: (+T) at Codon 9/10"

Copied!
2
0
0

Yükleniyor.... (view fulltext now)

Tam metin

(1)

Genetics Diagnosis Center, Adana Numune Training and

Research Hospital, Adana, Turkey Submitted 13.01.2015 Accepted 16.11.2015 Correspondance Adana Numune Eğitim ve Araştırma Hastanesi, Genetik Tanı Merkezi, Adana, Türkiye

Phone: +90 530 328 32 30 e.mail:

[email protected]

©Copyright 2016 by Erciyes University School of Medicine - Available online at www.erciyesmedj.com

A Rare β°-Thalassemia Frameshift Mutation in a Turkish Individual: (+T) at Codon 9/10

Akif Ayaz, Sinem Yalçıntepe, Sezin Canbek, Pembe Sağır, Özge Özalp Yüreğir

Erciyes Med J 2016; 38(1): 46-7 • DOI: 10.5152/etd.2016.0003

β-thalassemia is an autosomal recessive disorder caused by mutations that lead to deficiency (β+) or absence (β0) of β-globin chains (1). It is one of the most common inherited disorders of hemoglobin in Mediterranean countries, North Africa, and Southeast Asia (2). In Turkey, previous studies have reported the frequency of β-thalassemia at 2.0% (3). There are currently over 300 mutations affecting different levels of β-globin gene expressions by a vari- ety of mechanisms that are known to result in β-thalassemia phenotype (4). About 40 mutations associated with β-thalassemia have been described in Turkey (5, 6). Here, we report a rare β-globin gene mutation in a Turkish individual.

A 23-year-old woman consulted our Genetic Diagnosis Center from Hemoglobinopathy Disorders Center in Adana for hypochromic-microcytic anemia and high HbA2 levels in a routine test before marriage. Complete blood count (CBC) and high-performance liquid chromatography (HPLC) results were compatible with β-thalassemia heterozygous shown in Table 1. HPLC analysis showed levels of HbA2 and HbF at 4.3% and 1.3%, respectively.

Iron deficiency anemia was excluded.

Hemoglobin electrophoresis and CBC values of her husband were found to be normal. There was no consanguin- ity between her parents. Two sisters of our patient and their father had also anemia history, but we could not evaluate them.

β-globin gene mutation analysis was first performed by the strip assay technique (ViennaLab cat. no. 4–120; Vi- ennaLab Diagnostics, Vienna, Austria), which is based on the reverse-hybridization principle automatically. After the strip assay technique, direct sequencing of the Polymerase Chain Reaction (PCR) products was performed on an ABI 3130 Genetic Analyzer. The 3 exons of β globulin gene as well as 5’UTR, 3’UTR, promoter, and introns sequences replicated by PCR using primers given in Table 2. There was no mutation on strip assay, but Sanger sequencing detected Fsc 9/10 (+T) heterozygous mutation (Figure 1). This mutation is a rare mutation for β-thalassemia (7-10). A written informed consent for the publication was given by the patient.

Over the past two decades, a wide range of methods for DNA analysis have allowed us to identify such defects in globin genes that are associated with hemoglobin disorders. In this case, we report a rare mutation in the β-globin gene. This mutation is an insertion of one base (T) at codon 10 causing a frameshift mutation, resulting in a stop codon at codon 22 (Figure 2). mRNA reverse transcriptase–PCR should be used to evaluate the functional effects of this mutation for measuring level of β-globin. In this study, we could not use this method, but frameshift mutations of the β-globin gene frequently generate a new premature termination codon, which makes it impossible to synthesize normal functional protein and results in β0 thalassanemia (1).

Consequently, hypochromic-microcytic ane- mia with elevated HbA2 should be evalu- LETTER

TO THE EDITOR

46

Table 1. Haemotological data of patient detected hypochromic-microcytic anemia and high HbA2 levels HGB g/dL RBC G/uL MCV fL MCH pg HbA2 HbF

10.5 6.18 59.3 17.0 4.3 1.4

Table 2. Oligonucleotide sequences for PCR amplification and sequencing of the HBB gene

Regions Forward Reverse

β globin 1. Region 5’-CCAACTCCTAAGCCAGTGCC-‘3 5’-TGCAATCATTCGTCTGTTTCCC-‘3 β globin 2. Region 5’-TCCCTAATCTCTTTCTTTCAG-‘3 5’-TTTTCCCAAGGTTTGAACTAGC-‘3 PCR: polymerase chain reaction

(2)

ated carefully, and additional methods such as Sanger sequencing should be used if β-globin strip assay is normal. This situation may be important for genetic counseling especially when the individu- al’s spouse has thalassemia trait.

In conclusion, it is very important to report new or rare nucleotide changes in hemoglobin diseases (11). Defining the changes in this group will not only help explain the clinical findings of the patient

but also understand the possible interactions with known molecular defects. Also, describing the genetic changes will be definitely help- ful for the accurate genetic counseling for couples at risk.

Informed Consent: Informed consent was obtained from patients who participated in this study.

Peer-review: Externally peer-reviewed.

Authors’ Contributions: Conceived and designed the experiments or case: AA, ÖÖY. Performed the experiments or case: AA, SY. Analyzed the data: PS, SC. Wrote the paper: AA, SY, ÖÖY. All authors have read and approved the final manuscript.

Acknowledgement: We thank the patient for her contribution.

Conflict of Interest: No conflict of interest was declared by the authors.

Financial Disclosure: The authors declared that this study has received no financial support.

REFERENCES

1. Weatherall DJ, Clegg JB. The thalassemia syndromes. Oxford: Black- well Sciences, 2001. [CrossRef]

2. Angastiniotis M, Modell B. Global epidemiology of hemoglobin disor- ders. Ann NY Acad Sci 1998; 850: 251-69. [CrossRef]

3. Altay C. The frequency and distribution pattern of β-thalassemia mu- tations in Turkey. Turkish J Hematol 2002; 19(2): 309-15.

4. Akhavan-Niaki H, Derakhshandeh-Peykar P, Banihashemi A, Mosta- fazadeh A, Asghari B, Ahmadifard MR, et al. A comprehensive mol- eculer characterization of beta thalassemia in a highly heterogeneous population. Blood Cells Mol Dis 2011; 47(1): 29-32. [CrossRef]

5. Akar N, Cavdar AO, Dessi E, Loi A, Pirastu M, Cao A. Beta thal- assaemia mutations in Turkish population. J Med Genet 1987; 24(6):

378-9. [CrossRef]

6. Basak AN. The Molecular pathology of beta-thalassemia in Turkey:

The Boğazıcı University experience. Hemoglobin 2007; 31(2): 233- 41. [CrossRef]

7. Waye JS, Eng B, Oliveri NF, Chui DH. Identification of a novel beta O-thalassaemia mutation in a Greek family and subsequent prenatal diagnosis. Prenatal Diag 1994; 14(10): 929-32. [CrossRef]

8. Rahimi Z, Muniz A, Parsian A. Detection of responsible mutations for beta thalassemia in the Kermanshah Province of Iran using PCR- based techniques. Mol Biol Rep 2010; 37(1): 149-50. [CrossRef]

9. Gunesacar R, Celik MM. First report from Turkey of a rare frameshift mutation [codons 9/10 (+T)] in the beta-globin gene. Turk J Hematol 2011; 28: 343-5. [CrossRef]

10. Filon D, Oron V, Shawa R, Elborno E, Najjar K, Tulchinsky T, et al.

Spectrum of beta-thalassemia mutations in the Gaza area. Hum Mutat 1995; 5(4): 351-3. [CrossRef]

11. Giardine B, van Baal S, Kaimakis P, Riemer C, Miller W, Samara M, et al. HbVar database of human hemoglobin variants and thalassemia mutations: 2007 update. Hum Mutat 2007; 28(2): 206. [CrossRef]

Ayaz et al. A Rare β0-Thalassemia Frameshift Mutation

Erciyes Med J 2016; 38(1): 46-7

47

Figure 1. Partial DNA sequence showing a heterozygosity insertion of T at codon 10

11501104 10581012 966920 874828 782736 690644 598552 506460 414368 322276 230184 13892 460

1820 1834 1848 1862 1876 1890 1904 1918 1932 1946 1960 1974 1988 2002 2016 2030 2044 Heterozygosity insertion of T (one base)

GG G

G G

G G

G

161' 171

g '

K g

ş a

T ğ

T T

T T

ç T K

. . . . . .

TT

CC C

C ç

ç G

Ş C

A C

A A

A A A

Figure 2. (a, b). (a) Insertion of a single T nucleotide within the exon 1 at codon 10 of the β globin gene. With insertion of T at codon 10 and frameshift mutation causing amino acid sequence changings from codons 10 to 21, and then 22. codon converts to stop codon. (b) Normal amino acid sequences, differed amino acid sequences, and not synthesized region were demonstrated with blue, yellow and red, respectively

ATGGTGCATCTGACTCCTGAG GAGAAGTCT GCC GTTACTGCCCTGTGGGGCAAGGTGAACGTGGAT GAA

TGC CGTTACTGCCCTGTGGGGCAAGGTGAACGTGGA TGA Ala Val Thr Ala Lcu Trp Gly Lys Val Asn Val Asp Glu

Cys Arg Thr Cys Pro Val Gly Gln Gly Glu Arg Gly Stop

Codon 9 +T a

b

Exon 2 Exon 1

5' UTR IVS I IVS II 3' UTR

Codon 105-146 Codon

31-104 Codon

1-30

Cd 9-10 (+T) Cd 22 Stop

Exon 3

Codon 22

Referanslar

Benzer Belgeler

We hope that this special section will inspire more research in the field of physical design automation. We would like to thank all the authors who submitted papers to this

If, instead, a fixed interval method had been used, the number of rescheduling points would then depend on the makespan of the schedule, which in turn would

For the non-dominated solutions among this set of solutions that we obtain by running the algorithm, we give the TADC values of these solutions to the mathematical model as an

Yapıt odak figür Ömer’in toplum tarafından kullanılması ve dengesiz davranışları yüzünden hapishaneye gitmesi ve hapishaneden çıkınca Macide’ye daha fazla

Retrograd intrarenal cerrahinin minimal invaziv bir yöntem olu- şu, doğal orifis kullanılması, daha kısa hastanede kalış süresi ve holmiyum lazer ile birlikte

Adli diş hekimi tarafından ölüm öncesi diş kayıtları ile ölüm sonrası diş bulgularının karşılaştırılması bir cesedin kimliğinin tespit edilmesinde en etkili,

[r]

37 Bu çalışmada çatallaşma teorisine dayanılarak basit bir güç sisteminin dinamik gerilim kararlılığı analizi gerçekleştirilmiş ve bulunan sonuçlar verilen