• Sonuç bulunamadı

The genotoxic effects of mixture of aluminum,arsenic, cadmium, cobalt, and chromium on thegill tissue of adult zebrafish (Danio rerio, Hamilton1822)

N/A
N/A
Protected

Academic year: 2021

Share "The genotoxic effects of mixture of aluminum,arsenic, cadmium, cobalt, and chromium on thegill tissue of adult zebrafish (Danio rerio, Hamilton1822)"

Copied!
11
0
0

Yükleniyor.... (view fulltext now)

Tam metin

(1)

Full Terms & Conditions of access and use can be found at

https://www.tandfonline.com/action/journalInformation?journalCode=idct20

Drug and Chemical Toxicology

ISSN: (Print) (Online) Journal homepage: https://www.tandfonline.com/loi/idct20

The genotoxic effects of mixture of aluminum,

arsenic, cadmium, cobalt, and chromium on the

gill tissue of adult zebrafish (Danio rerio, Hamilton

1822)

Fulya Dilek Gökalp , Oğuzhan Doğanlar , Zeynep Banu Doğanlar & Utku

Güner

To cite this article: Fulya Dilek Gökalp , Oğuzhan Doğanlar , Zeynep Banu Doğanlar & Utku Güner (2020): The genotoxic effects of mixture of aluminum, arsenic, cadmium, cobalt, and chromium on the gill tissue of adult zebrafish (Danio�rerio, Hamilton 1822), Drug and Chemical Toxicology, DOI:

10.1080/01480545.2020.1810260

To link to this article: https://doi.org/10.1080/01480545.2020.1810260

Published online: 26 Aug 2020.

Submit your article to this journal

View related articles

View Crossmark data

(2)

ORIGINAL ARTICLE

The genotoxic effects of mixture of aluminum, arsenic, cadmium, cobalt, and

chromium on the gill tissue of adult zebrafish ( Danio rerio, Hamilton 1822)

Fulya Dilek G€okalpa , Oguzhan Doganlarb , Zeynep Banu Doganlarb and Utku G€unera

aScience Faculty, Department of Biology, Trakya University, Edirne, Turkey;bMedicine Faculty, Department of Medicine Biology, Trakya University, Edirne, Turkey

ABSTRACT

The aim of this study is to investigate the genotoxic effects of mixtures of five metals on zebrafish at two different concentrations; at the permissible maximum contamination levels in drinking water and irrigation waters. The drinking water limits are as follows: 300mg/L for Aluminum (Alþ3), 10mg/L for Arsenic (Asþ3), 5mg/L for Cadmium (Cdþ2), 10mg/L for Cobalt (Coþ2), and 50mg/L for Chromium (Crþ2).

The irrigation water limits: 5000mg/L for Alþ3, 100mg/L for Asþ3, 10mg/L for Cdþ2, 50mg/L for Coþ2, and 100mg/L for Crþ2. The zebrafish underwent chronic exposure for periods of 5, 10, and 20 days. The gene expressions for mitochondrial superoxide dismutase (SOD2), stress-specific receptor protein NCCRP1, the heat shock proteins: Hsp9, Hsp14, Hsp60, Hsp70, DNA repair (XRCC1 and EXO1), and apoptosis (BOK and BAX) were evaluated. It was found that exposure to the low- and high-concentra- tions of the heavy metal mixtures caused cell stress, an increased expression of the antioxidant genes, and repair proteins. As the duration of exposure was increased, the cells progressed through the apop- totic pathway. This was more evident in the high-concentration exposure groups. The results demon- strated the necessity for a reevaluation of the maximum values of heavy metal and toxic element concentrations as prescribed by the Local Standing Rules of Water Pollution Control Regulation, as well as a reevaluation of the limitations of heavy metal mixture interactions with respect to ecological bal- ance and environmental health.

HIGHLIGHTS

 The purpose of this study was to investigate the genotoxic effects of a mixture of Aluminum, Arsenic, Cadmium, Cobalt, Chromium on zebrafish, within drinking water, and irrigation water limits determining the concentration.

 The zebrafish were exposed to two different concentrations of each metal mixture for 5-, 10-, and 20-day periods. Following exposure, gene expressions of the zebrafish’s gill tissues were examined.

 As a result of the exposure to the metal mixtures, the following occurred: cell stress, increased anti- oxidant gene activity, and attempts to protect cell viability. However, the cells progressed through the apoptotic pathway after prolonged exposure.

 The results demonstrated the necessity for a reevaluation of the maximum limits of metal and toxic element concentrations as stated in the Standing Rules of Water Pollution Control Regulation.

ARTICLE HISTORY Received 13 March 2020 Revised 28 July 2020 Accepted 8 August 2020

KEYWORDS

Genotoxicity; metal mixture;

gene expression; apoptosis;

DNA repair; heat shock proteins

1. Introduction

In a contaminated environment, drinking and surface waters carry an excessive amounts of metal charge (Fu et al. 2014), and these are usually being found in mixtures forms (Komjarova and Bury 2014). Metals found in contaminated waters are taken in by organisms which may lead to accumu- lation and toxic effects due to the interactions between the heavy metals (Komjarova and Blust 2009). The necessity of inland or drinking water standards is evident for the sake of protecting both public health and the environment. These standards are set by first determining the toxic effects of chemicals and metals, separately, and then by finding limit values based upon the data. However, within a natural envir- onment, chemicals and metals coexist. Furthermore, the val- ues for heavy metals are too low and it is unclear how the

heavy metals behave when the exist in a mixture, as such, their effect on the presence of metals in mixtures is dubious.

The complexity of the immune system and the metabolic pathways, in addition to the environment, lead to the impos- sibility of predicting the effects of metal mixtures based solely upon the effects of individual metals. As such, it is important to investigate the effects of chemical and metal mixtures in order to determine more accurate standard limits.

The estimate of effect for complex metal mixtures and their biological interactions has produced remarkable results in terms of their effect on human life and also for ecological risk assessments. Researchers have found that individual met- als generate reactive oxygen species (ROS). ROSs have been known to cause oxidative stress and the depletion of both glutathione and of bond sulfhydryl groups. The toxicity of

CONTACTFulya Dilek G€okalp [email protected] Science Faculty, Department of Biology, Trakya University, Edirne, Turkey ß 2020 Informa UK Limited, trading as Taylor & Francis Group

DRUG AND CHEMICAL TOXICOLOGY

https://doi.org/10.1080/01480545.2020.1810260

(3)

the metals Pb, Hg, As, and Cd may be explained using both concentration addition and independent addition models (Wu et al. 2016). Jadhav et al. (2007a) also studied the toxic effects of complex metal mixtures on organisms. The concen- trations were determined by the local inland water limit and the WHO drinking water maximum permissible limit on rats for a period of 90 days. Subchronic exposures to the metal mixture affected the functional and structural integrity of the studied tissues at 10 and 100 times the minimum mode con- centration of the individual metals (Jadhav et al. 2007b).

After exposure to the metal mixture, hematoporetic and immune system toxicological effects were also observed (Jadhav et al. 2007c) to have induced oxidative stress and reduced the antioxidative defense system in the erythrocytes (Jadhav et al. 2007a). It has been indicated by researchers that there were synergistic immunotoxic effects following a coexposure of arsenic and lead (Bishayi and Sengupta 2006).

It has also been found that cobalt and lead fell below the threshold limit values (Jung 2003), and, finally, there was an increased toxic effect following a coexposure of cadmium, cobalt, and lead (Hengstler2003).

This situation is complex due to the fact that these metals interact with fundamental cellular targets. However, they pos- sess different target affinities. These interactions differ depending on the following: the metals present in the envir- onment, their concentrations, the means and duration of exposure, the species, and the organs researched (Beyer et al.

2014). It may be stated that studies determining the toxicity of a single metal outside of a complex, natural environment do not reflect reality, and, as such, are not as valuable when composing water quality standards.

According to the current standards, the toxic effects of metals are defined as being either high or low (Komjarova and Bury 2014). Therefore, during the preparation of specific water quality standards for a region, it is necessary to investi- gate the consequences of the coexistence of some metals in order to determine said standards (Norwood et al. 2003).

Although there exists more pollutants beyond heavy metals in the environment, there is relatively a little data available pertaining to their toxic response interactions of the tar- get organisms.

In the past few years, interest in metal mixture toxicity has grown. The authorities who determine pollution stand- ards have done so by evaluating toxic mixtures on aquatic organisms (USEPA 2007). Determining the genotoxic effects of metal and pesticide concentrations on the environment and in organisms is one of the more popular types of toxicol- ogy studies conducted (Lokke et al. 2013, Wu et al. 2016).

Metal–metal interactions, due to their concentrations in the environment, have been conducted on many different fish species (Olvera-Nestor et al. 2016, Gomez-Olivan et al. 2017, Stankeviciute et al. 2017, Stankeviciute et al. 2018). Heavy metals cause damage to proteins, DNA, and cellular lipids.

They even cause cell death via the creation ROSs (Leonard et al.2004, Valko et al.2005).

Studies using fish have noted that the toxic effects of Aluminum (Alþ3) were localized on the apical surfaces of the gills and were found to inhibit osmoregulation (McDonald et al. 1989). Alþ3 changed the chemical conditions on the

surfaces and this led to defects in respiration and ion osmo- regulation. The functional groups that were formed on the apical gill surface disrupted the properties of the cell layers (Exley et al. 1991). In carp, it has been demonstrated that Alþ3caused DNA damage, apoptosis, and cell cycle arrest on the lymphocytes (Cyprinus carpio) (Garcia-Medina et al.2011).

The DNA damage induced by Alþ3 was found to be due to either oxidative stress or DNase activity (Banasik et al. 2005, Fernandez-Davila et al.2012).

Cadmium (Cdþ2) compounds are spread to the environ- ment through industrial activity and fossil fuels. Following dispersal, they may accumulate within aquatic organisms and, following consumption, lead to negative effects in humans (Wu et al. 2016). It has been stated that Cdþ2 acti- vates certain proto-oncogenes in addition to certain genes related to cell proliferation (Waalkes 2000). It has been reported that Cdþ2 caused cancer in zebrafish liver cell lines by inducing cell proliferation and suppressing apoptosis (Chen et al. 2014). Cdþ2 is classified by the International Cancer Research Agency as a carcinogen to humans due to its toxic effects (IARC 1993). Several mechanisms have been proposed to be cancer inducing due to the exposure to Cdþ2. Cdþ2causes reactive oxygen derivatives to disrupt the cellular antioxidant system (Deng et al. 2010), causing the inhibition of DNA repair mechanisms by changing DNA methylation (Pierron et al. 2014), the malfunction of cell adhesion (Doi et al. 2010), the malfunction of cell signal transduction (Thevenod 2009), and cell proliferation (Templeton and Liu2010).

Arsenic (Asþ3) is a naturally occurring pollutant and is clas- sified as a metalloid. It is released into the environment via industrial and agricultural emissions (Nandi et al. 2005). Low doses of Asþ3 (<10 ppb) have been found to cause changes in the endocrine system which lead to dysfunction in cell cycle kinetics, cell signals, and the proliferative response (Rossman et al.2004). It has been found that drinking water containing concentrations of Asþ3 cause changes in gene expressions and interactions with DNA repair mechanisms (Hughes et al. 2011). It is known that even a low dose of Asþ3 affects biological systems and has redox activity.

Therefore, its carcinogenetic effect is the result of incorrect gene expressions regulating cell proliferation (Hughes et al.

2011). Chen et al. (2004) stated that, at 45 ppm, Asþ3 within mouse liver cells (120/SvJ) changed DNA methylation and gene expressions in steroid-related genes. It also changed the cytokines as well as the genes allowing for cell cycle reg- ulations and apoptosis (Chen et al. 2004, Chowdhury et al.2010).

Cobalt (Coþ2) and Chromium (Crþ2), two commonly found metals, are considered to be harmful to human health (Valko et al.2005). Moreover, they can cause acute toxicity and can- cer in the long-term (Fu and Boffetta1995). Following expos- ure, it has been shown that Crþ2and Coþ2changed 696 and 461 types of gene expressions, respectively, in zebrafish (Ventura-Lima et al. 2009, Baer et al.2014). These are expres- sions for the adaptive response genes which control the acute phase response, cell cycle regulation, apoptosis, and metabolic suppression (Baer et al. 2014). It has been found that there is a concentration-response relationship between

(4)

fish death and concentrations of Coþ2 and Crþ2. They are also purported to suppress the regulation of the biological processes associated with the oxidative stress response, including oxidation–reduction (Hussainzada et al. 2014). It was also indicated that Cr(IV) induced oxidative stress in Anguilla anguilla (Ahmad et al.2006), and that the genotoxic- ity was due to free radicals which led to the crosslinking of DNA proteins (Lushchak et al. 2008) and further induced micronucleus and tail DNA (Comet assay) after both 48-h and 96-h Cr(IV) exposures (Ahmed et al.2013).

It is evident from previous studies that that Alþ3, Asþ3, Cdþ2, Coþ2, and Crþ2 changed the cell cycle and had detrimental effects on the antioxidant system. Some increased cell prolifer- ation, while others changed a large number of gene expres- sions and disrupted the DNA repair process. As such, it would be of benefit to further study the toxic effects of these metals as they would be within the environment, i.e. as a mixture.

The number of studies evaluating the genotoxic effect of metal mixtures on fish is growing. It has been demonstrated that, within the environment, the concentration of these met- als and their uptake as mixtures in organisms is complex. The interaction between elements has a key role in the uptake from the environment, accumulation in the tissue, and the understanding of toxicity mechanisms (Komjarova and Blust 2009). In low doses, metal-metal interactions have been studied in several types of fish. The dose was determined by the concentrations found present in the environment (Tao et al. 1999, Birceanu et al.2008). Sub-chronic exposure stud- ies are conducted using low concentrations of metals or chemicals. In order to evaluate the genotoxic effects of metal co-exposure, drinking, and irrigation water metal limits must be tested in vivo, and the concentrations must be within the current permissible limits.

The zebrafish (Danio rerio) is one of the organism for studying human genotoxicity, cancer, DNA damage, and drug improvement, because of zebrafish have a great homology with human genes (Shive 2013, Chen et al. 2014, Dai et al.

2014). Additionally, the investigation of the response of gill tissue to heavy metals is critical due to its direct contact with, as well as being a primary target of, toxic chemicals (Wang et al.2015). The purpose of this study was to investi- gate the short and long-term genotoxic effects (5-, 10-, and 20-day) of a mixture of five heavy metals at the permissible maximum contamination levels for drinking water (low- concentration) and irrigation water (high-concentration) in the gill tissue of zebrafish (Official Newspaper, 1991, 2013, 2017). The mixture contained Alþ3, Asþ3, Cdþ2, Coþ2, and Crþ2, which are commonly found in contaminated irrigation and drinking water. The samples of gill tissue were extracted from the zebrafish and were tested for gene expressions belonging to the antioxidant enzymes, gene repair mecha- nisms, heat shock proteins, and apoptosis pathways.

2. Materials and methods 2.1. Experimental fish

This study was conducted with the approval of the Trakya University Local Ethics Committee of Animal Experiments

(Decision No: 2015.05.02). The zebrafish (Danio rerio) used in this study were obtained from commercial companies and they were brought to the Trakya University Biology Department’s Aquatic Animal Experiment Research Laboratory in plastic bags.

The fish were acclimated for a period of 2 weeks in 5050100 cm3, 100 L aquariums. The water was kept at a temperature of 26C under permanent ventilation and a pH of between 7and 8 was maintained during the night and day peri- ods. During the acclimation process, the fish were fed dry fish food, daily.

2.2. Metal concentrations and treatment

The metal concentrations tested in this study were deter- mined according to the irrigation water and drinking water limits as per local pollution control regulations for consump- tion. To this end, two concentration series were used. The lowest concentration was determined according to the Turkish Public Health Institution regulation for water used for human consumption (for Asþ3, Cdþ2, and Crþ2: 10, 5, and 50mg/L, respectively) (Official Newspaper 2013) and accord- ing to the Turkish Republic’s Standards of Water Pollution Control Regulations for the acceptable limits of inland water resources for drinking water quality in Class 1 (for Co and Al:

10 and 300mg/L, respectively) (Official Newspaper1991). The highest concentration was determined according to the Turkish Republic’s Ministry of Environment and Forest Communique on technical procedures for water pollution control regulation at allowed irrigation water limits (Asþ3, Cdþ2, Crþ2, Coþ2, and Alþ3: 100, 10, 100, 50, and 5000mg/L, respectively) (Official Newspaper2017).

Under static test conditions, the zebrafish were exposed to Alþ3, Asþ3, Cdþ2, Coþ2, and Crþ2 in two different concen- tration series for 5-, 10-, and 20-day periods in aerated aquar- iums. The Zebrafish were divided into control and exposure groups. Each group contained 5 fish. The temperature of the aquarium was kept between 24C and 26C. Light was regu- lated in 12-hour day/night cycles. Treatment solutions were changed daily. Feeding was done once a day with dry food.

The control group was not exposed to the metal mixtures.

Both the control and heavy metal-treated experiments were performed with three replicates. At the end of the study, the fish was euthanized via anesthesia in a pellet ice and water mixture. After which, gill dissection was performed. The gills were removed, frozen in liquid nitrogen, and then stored in a deep freeze at86C for further genetic analysis.

2.3. RNA isolation and cDNA synthesis

The total RNA was isolated according to the RNA kit protocol by using the Total RNA PureLinkVR RNA Mini Kit (Life Sciences). The amount of isolated RNA in the tissues was determined via an OPTIZEN NanoQ micro-volume photom- eter. The total concentration of RNA was adjusted to 50 ng/ll in the synthesis of the first chain of complementary DNA (cDNA), by using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). The cDNA synthesis was performed using the BiosystemsVR ProFlexTM system (step 1: 25C, for

DRUG AND CHEMICAL TOXICOLOGY 3

(5)

10 min; step 2: 37C, for 120 min; step 3: 85C, for 5 min).

The cDNA obtained was kept at 20C to be used in fur- ther analysis.

2.4. Real time-PCR (RT-PCR) studies

The gene expressions for the DNA repair pathway proteins, antioxidant enzymes, heat shock proteins, and apoptosis were analyzed via qRT-PCR by using the SYBRVR Select Master Mix (Life Technologies) on an ABI Step One Plus Real-Time PCR system with the primer pairs shown in Table 1. The PCR cycling conditions were as follows: 1 cycle for 2 min, at 50C and for 10 min, at 95C. Next, a 40-cycle denaturation pro- cess (at 95C, for 15 s) was performed, followed by annealing and extension (for 1 min at 60C). The mRNA expressions were calculated using the comparative cycle threshold method (2–DDCt) and this was taken to be the relative fold change as compared to the control. Finally, this was normal- ized with the 18S mRNA expression.

2.5. Statistical analysis

An ANOVA test was used to compare the control and experi- mental groups. A Duncan test was performed to determine their significance. The levels of significance (p 0.05) were arranged using SPSS 18 software.

3. Results

3.1. Gene expressions

With regards to gene expression, mitochondrial Mn- Superoxide dismutase (SOD2) and the nonspecific cytotoxic cell receptor protein gene (NCCRP1) were analyzed via qRT- PCR. Exposure to the metal mixture took place during 5-, 10-, and 20-day periods with increasing concentrations of said mixture. Exposure caused high levels of oxidative stress in the zebrafish tissues. The mature zebrafish demonstrated a re-regulation of their own antioxidant genes as a first line of defense. On the fifth day, there was a significant increase in the expression of the antioxidant genes, mitochondrial SOD2 gene, and the stress-specific receptor protein NCCRP1 gene.

The highest gene expressions at the end of the fifth day were detected in the SOD2 gene. The SOD2 gene expression was found to have an 11.37 ± 0 0.53 and a 23.31 ± 2.15-fold increase for the high and low metal concentration exposures, respectively. InFigure 1, it may be seen that there was a sud- den increase on the fifth day of exposure. The antioxidant gene expression levels decreased on the 10th and 20th days of exposure. Despite this, the results remained significant when compared to the control (Figure 1).

The HSP family proteins are important protein chaperones that help to refold proteins that are misfolded or damaged due to cell stress. If there is irreparable damage, then these proteins undergo degradation. From the HSP group 4, gene expressions were studied. Listed from low and very high molecular weight the following were examined: HSP9, HSP14, HSP60, and HSP70 (Figure 2).

This study also found that the heat shock protein gene expression levels were similar to the antioxidant gene expres- sion results. Higher expression levels were observed in the 5- day exposures as compared to the 10- and 20-day long-term exposures. Heat shock protein gene expressions showed par- tial decreases by 10th and 20th days. The 5-day metal mix- ture exposure did not cause a statistically significant difference in the low molecular weight HSPs. However, the mitochondrial HSP60 and HSP70 genes responsible for stress- specific protein folding, were increased by 5.66 ± 0.48, 2.43 ± 0.12, and 5.87 ± 0.51, 7.38 ± 0.125 times in the low- and high-concentration exposures, respectively. Although expres- sions of the heat shock protein genes had decreased after the 10th day of exposure when compared to the 5-day exposure, their levels were still significant when compared to their control, with the exception of the HSP9 gene. After the longest exposure period (20 days), only the HSP60 expres- sions had a statistically significant increase in both the low and high dose exposures. The expressions for the other HSP genes with lower molecular weights, in addition to the stress-specific HSP70 gene, were not increased significantly when compared to the control group (Figure 2).

The XRCC1, EXO1, BAX, and BOK gene expressions (which are related to DNA repair and the programed cellular death mechanisms) were also studied (Figure 3). During the first 5 days of exposure, DNA repair mechanisms were rapidly acti- vated in cells compared to the control group. The expression of the XRCC1 gene had increased (4.5 and 7.8 times) by the 5th day of exposure. However, it had decreased after both the 10th and 20th day of exposure. The expression of the EXO1 gene did not show a statistically significant change when compared to the control group after the 5th day of exposure. Exposure to the low dose mixture induced EXO1 gene expression as exposure time increased. However, a dra- matic decrease was observed in the fish exposed to the high-concentration metal mixture. Both gene expressions did not show a significant increase after long-term exposure when compared to the control group (Figure 3). A dramatic

Table 1. Genes and primer sequences in the study of qRT-PCR are given below.

Gene Primer sequences

SOD2 F 50TCTGAAGAAGGCCATCGAGT 30

R 50GCAGATAGTAGGCGTGCTCC 30

NCCRP1 F 50TGTTGTGATCTGCCAGCTTC 30

R 50AGCACTCCAGGTCCTCTTCA 30

XRCC1 F 50AGTCTCCTTCTGCTGGGTCA 30

R 50ACAAACACCACTCCCTCCAG 30

EXO1 F 50GACCATTTCACCACCCACTTT 30

R 50TGAGACTCATCGTCACTGGACTC 30

HSPa9 F 50CGACTTGGGAACCACAAACT 30

R 50CTGGCCCAAGTAGCTTTCAG 30

HSPa14 F 50CGAGCAGATGTTGTAGCCAA 30

R 50GACGTCTTCAGGGGACACAT 30

HSP70 F 50CGAGETCGACGCATTGTTTG 30

R 50GAGTGGATCCGCCGACGAGTA 30

HSP60 F 50GTCGCGCCCCGTTAGCAC 30

R 50CATCGCGTCCCACCTTCTTCAT 30

BAX F 50TTCATCCAGGATCGAGCAGA 30

R 50GCAAAGTAGAAGGCAACG 30

BOKb F 50CGTCTTTCAGTCCAAGGAGC 30

R 50ACCACAGCTTCCACCGATAC 30

GADPH F 50TTGGTATCGTGGAAGGACTCA 30

R 50TGTCATCATATTTGGCAGGTTT 30

(6)

increase was observed in the apoptosis-related gene expres- sions. A time-dependent increase in the expression of the BOK gene was observed after exposure to the high-concen- tration mixture. This increase was the highest after 20 days.

This result was observed in the DNA repair mechanisms of the tissues and cells that had triggered apoptosis, which is a specially programed cellular death mechanism. The BOK and BAX gene expressions, which are responsible for mitochon- drial membrane permeability, showed a significant increase when compared to control group in all three exposure peri- ods and in both concentrations (Figure 3).

4. Discussion

The metal-induced stress resulted in the rapid production of ROSs, which are highly oxygenated compounds possessing non-paired electrons in the outer orbitals. ROSs cause DNA and membrane damage in cells and also disrupt the protein and lipid balance, which causes the enzyme hormone mech- anism functions to fail (Wu et al.2016). As a result, this dam- ages neural transmission, leading to neurotoxic effects, various cardiovascular diseases, immune system disorders, and various types of cancer. This damage is prevented by various defense mechanisms.

A group of enzymes, named antioxidant enzymes, are the primary defense mechanisms curbing the effects of ROSs.

Superoxide dismutase (SOD) and Catalase (CAT) are the best-

Control LC HC

0 1 2 3 4

Relative fold change HSP9

#

*

#

*

5th days 10th days 20th days

Control LC HC

0 2 4 6

Relative fold change *

#

¥

HSP14

*

Control LC HC

0 2 4 6 8

Relative fold change *

#

#

#¥

HSP60

#

#¥

#¥

*

Control LC HC

0 3 6 9 12

Heavy metal mixture

Relative fold change *

#

#

# *

* HSP70

#

**

*

Figure 2. The relative fold change determined by quantitative real-time PCR analysis (qRT-PCR) of heat shock protein family genes (HSP9, HSP14, HSP60, and HSP70) in the Control group, LC-, and HC-exposed gill tissue of zebrafish. All data were normal- ized with the GADPH expression presented as relative to the control; Data were rep- resented by the mean ± SD. #P  0.05; untreated control vs heavy metal exposed groups; P  0.05; 5-day vs 10-day vs 20 day, ¥P  0.05; LC vs HC at the same expos- ure time. Data are represented by the mean ± SE.P values are shown on graphs cal- culated using the one-way ANOVA with Tukey HSD test. Control: untreated control, LC: Low-concentration (drinking water levels), with Al at 300mg/L, As at 10 mg/L, Cd at 5mg/L, Co at 10 mg/L, Cr at 50 mg/L, HC: high concentration (irrigation water levels), with Al at 5000mg/L, As at 100 mg/L, Cd at 10 mg/L, Co at 50 mg/L, Cr at 100 mg/L.

Control LC HC

0 2 4 6 8

Relative fold change 5th days

10th days 20th days

*

¥

*

#

#

#

#

¥

* NCCRP1

Control LC HC

0 10 20 30

Relative fold change

*

*

#

#

#

*

*

¥

*

#

¥ #¥

SOD2

Figure 1. The relative fold change as determined by a quantitative real-time PCR analysis (qRT-PCR) of the NCCRP1 protein and antioxidant enzyme gene (SOD2) in the Control, LC and HC-exposed gill tissue of the zebrafish. All data were normalized with the GADPH expression and presented as relative to the control; Data was represented by the mean ± SD. #P  0.05; untreated control vs heavy metal exposure groups; P  0.05; 5-day vs 10-day vs 20-day,

¥P  0.05; LC vs HC for the same exposure time. Data are represented by the mean ± SE.P values are shown on graphs calculated using the one-way ANOVA with Tukey HSD test. Control: untreated control, LC: Low-concentration (drinking water levels): with Al at 300mg/L, As at 10 mg/L, Cd at 5 mg/L, Co at 10 mg/L, Cr at 50mg/L, HC: high concentration (irrigation water levels): with Al at 5000 mg/L, As at 100mg/L, Cd at 10 mg/L, Co at 50 mg/L, Cr at 100 mg/L.

DRUG AND CHEMICAL TOXICOLOGY 5

(7)

known enzymatic antioxidants. SOD is the primary defense mechanism and it acts as a catalyst in the transformation of the superoxide anion (O2) to hydrogen peroxide (H2O2)

and oxygen, reducing the effects of these radicals. CAT acts as a catalyst in the transformation of the H2O2,produced dur- ing the SOD enzyme activity, into water and oxygen (Bourg2001).

The NCCRP1 gene serves as a cytosolic stress protein receptor in zebrafish tissues and increases under stress condi- tions (Seppola et al.2007). Studies have reported that antioxi- dant activities increase due to metal contamination in living organisms (Dobrakowski et al. 2017). Similar results were detected in the samples where heavy metal mixtures were tested (Jadhav et al. 2007b, Whittaker et al. 2011). Although under different stress conditions, the changes in these enzymes were found in previous studies (Doganlar et al.

2014, Doganlar and Doganlar 2015, Doganlar et al. 2015).

Heavy metal toxicity is primarily mediated by its interference between metabolic intracellular activity and by the gener- ation of injurious free radical species. Imbalance in the pro- duction and removal of ROSs is the main mechanism of metal-induced oxidative stress (Nita and Grzybowski 2016, Batool 2017). Enhanced ROS concentrations cause cellular injury and damage to lipids, proteins, and biological macro- molecules (Sanders et al.2009, Sharma et al.2014).

In our previous study, cytosolic SOD and CAT gene expres- sion levels were examined. In that study, SOD and CAT acti- vation were similar to that of NCCRP1 and SOD2. SOD and CAT gene expressions were increased 2.6–2.7 times after the low-dose exposure and 4.3–8.5 times after the high-dose exposure by the end of the 5th day (Kanev2016). In the pre- sent study, the 5-day exposure results were in accordance with the other studies, in that the exposure to heavy metals induced oxidative stress that resulted in an increase of both stress-specific receptors and antioxidant genes. The levels of gene expression decreased over long-term exposures. The reason is thought to be due to either the accumulation of metal in tissues, which would lead to severe protein damage as well as damage to the protein structure of enzymes or gene damage, directly. Furthermore, the damage could lead to the prevention of the synthesis of these enzymes.

In recent studies, it has been indicated that some ele- ments cause toxicity due to the production of ROSs.

Oxidative stress has been proposed as a major mechanism behind the Cd (Ghasemi et al. 2014), Pb (Valko et al. 2005, Flora et al. 2008), Chromium(IV) (Arakawa et al. 2012, Ghasemi et al. 2014) toxicities in heavy metal-induced cell death and carcinogenesis (Ghasemi et al. 2014). It has also been shown that the generation of oxidative stress is a major pathway for some metals, such as Pb, Cd, and Chromium(III), to induce tissue and DNA damage, alter gene expression, and induce apoptosis (Sanders et al. 2009, Sharma et al.

2014). In this study, antioxidant gene activity was high on the 5th day of exposure but decreased through 10thand 20th days of exposure. As a result, apoptosis was induced. Unlike the antioxidant gene expressions, the apoptosis genes were increasingly expressed in the high-dose mixture, resulting in cell death from the 5th day onward.

After lung tissue had been exposed to welding fumes (which include Cr, Mn, and Ni) it was observed that ROSs were produced and that S-transferase (GST), NAD(P)H quinine oxidoreductase 1 (NQO1), SOD, and CAT enzyme expressions

Control LC HC

0 3 6 9 12

Relative fold change

*

#

#

# *

* XRCC1

#

**

*

#¥

5th days 10th days 20th days

Control LC HC

0 2 4 6 8

Relative fold change EXO1

*

¥

#

Control LC HC

0 2 4 6 8

Relative fold change BAX

*

¥

#

# #

*

# *

#

¥#

Control LC HC

0 10 20 30

Heavy metal mixture

Relative fold change

*

# #

#

*

¥

#

#¥

BOK

#

Figure 3. The relative fold change as determined by quantitative real-time PCR ana- lysis (qRT-PCR) of the DNA repair (XRCC1 and EXO1) and pro-apoptotic (BAX and BOK) genes in the Control, LC, and HC-exposed gill tissue of zebrafish. All data were normalized with the GAPDH expression and presented relative to the control; Data were represented by the mean ± SD. #P  0.05; untreated control vs heavy metal exposure groups; P  0.05; 5-day vs 10-day vs 20-day, ¥P  0.05; LC vs HC at the same exposure time. Data are represented as mean ± SE.P values are shown on graphs and were calculated using the one-way ANOVA with Tukey HSD test. Control:

untreated control, LC: Low-concentration (drinking water levels), with Al at 300mg/L, As at 10mg/L, Cd at 5 mg/L, Co at 10 mg/L, and Cr at 50 mg/L, HC: high-concentration (irrigation water levels), with Al at 5000mg/L, As at 100 mg/L, Cd at 10 mg/L, Co at 50mg/L, and Cr at 100 mg/L.

(8)

had increased (Krishnaraj et al.2017). As a result of the ROS generation, DNA damage occurred. It has been demonstrated that there was an increase in the XRCC1 protein (DNA repair) and cell cycle arrest during the G0–G1 phase, indicating apoptosis (Krishnaraj et al.2017). Similarly, in this study, DNA damage due to the generation of ROSs increased DNA repair and continuous exposure to the heavy metal mixtures induced apoptosis.

Stemming from the exposure to the heavy metal mixture, the ROSs that were increased due to oxidative stress attacked many macro and micro molecules in the sample cells. The RNA and other genetic material were especially affected. The damage it incurred (mismatched or broken chains of mRNA) caused translation faults. ROSs are also known to attack cor- rectly translated proteins and causes said proteins to fold incorrectly or become damaged. In both situations, these proteins lose their function and some of them turn into harmful forms that damage cells. This situation is corrected by the heat shock protein family (HSPs). DNA damage and the increase in the mitochondrial SOD and mitochondrial HSP60 gene expressions showed that the DNA damage was especially concentrated in the mitochondria. Also, the increase in the HSP70 gene is thought to be due to damage in the stress proteins. Studies have shown that the increase in HSP gene expressions was related to the cytotoxic effects and the repair or the removal activities of misfolded proteins.

HSPs regulate metabolic activities (Wang et al.2011) and for this reason they play a preventive role in the cell’s response to stress. It has been determined that among the HSP fami- lies, the HSP70 family plays an important role in the reaction to toxic substances (Coelho et al.2017). A positive correlation between HSP70 and the toxic agents in the organisms D.

melanogaster (benzene, xylene, toluene), Ostrea edulis (heat and heavy metals), rat embryos (arsenate), rats (carbon tetra- chloride), and fish (industrial waste, polycyclic aromatic hydrocarbons, pesticides, and heavy metals) was reported (Gao et al. 2007, Roh et al. 2006). Moreover, Scheil et al.

(2010) reported that HSP70 was a sensitive biomarker in zebrafish that have undergone chlorpyrifos and nickel expos- ure. The results of this study supported previous studies. This is especially true with regards to the exposure to heavy met- als, in that the stress proteins HSP60 and HSP70 were deter- mined to have more active roles in the zebrafish gill tissues than those of the HSP14 and HSP9 proteins.

In this study, it was shown that exposure to the metal mixture concentrations caused genetic damage. This damage is thought to have occurred due to the oxidative stress caused by a significant increase in antioxidant gene expres- sions. However, the XRCC1 protein (one of the gene repair mechanisms) was expressed effectively after 5 days of expos- ure. The expressions of the XRCC1 gene and the EXO1 gene did not show any statistically significant increases in either the dose and exposure period. This situation implies that there might be irreparable genetic damage occurring in the cells. This may be due to the overexpression of the stress- specific HSP70 and mitochondrial HSP60 genes’ having mis- folded or synthesized defective proteins.

In this study, an increase in the gene expressions for DNA damage indicated that the BAX and BOK gene expression

levels were responsible for mitochondrial apoptosis in the cells. The BAX and BOK genes are pro-apoptotic proteins and are the most important genes of the mitochondrial apoptosis pathway. Their increase in density causes malfunctions in both the mitochondrial membrane potential and permeability (Fernandez-Marrero et al. 2017). These malfunctions trigger the apoptosis mechanism and cause the Cytochrome-C within the mitochondria to leak into the cell cytosol due to the damaged membrane potential (Iguchi et al.2018). When Cytochrome-C increases in the cell cytosol, it interacts with the APAF-1 protein. APAF-1 is also in the cell cytosol and its expression increases during the apoptosis process. This pro- tein unit also combines with Caspase 9 and the apoptosomes (an apoptosis substructure) (Tashakor et al. 2019). In this phase, the apoptosomes trigger the protein Caspase 3 and, due to the increase in Caspase 3 expressions, the cell enters the death pathway. The mitochondrial apoptosis cycle is completed in this way. It is thought that the BAX and BOK genes, which are overexpressed during this process, are bio- markers for cell apoptosis. Excess ROS production disrupts the metabolic pathways of the cell. This may result in cell death or carcinogenesis. An increase in intracellular concen- trations of metal chelators and antioxidant molecules can reduce heavy metal-induced oxidative damage and ROS pro- duction (Shaikh et al. 1999, Sahin et al. 2003, Cuypers et al.

2010, Guha et al. 2011). Also, strong antioxidants such as melatonin, vitamin E, vitamin C, N-acetylcysteine, certain plant extracts, and metallothionein attenuate metal toxicity in living tissues (Kostova and Balkansky 2013, Tavakol et al.

2015, Gaurav et al.2020).

As a result, exposure to the low- and high-concentrations of the metal mixture caused stress in the zebrafish cells, and increased the antioxidant gene activity needed for cell sur- vival. However, as the duration of exposure was increased, the cells entered the apoptotic pathway. This was more evi- dent in the high-concentration exposure groups. The neces- sity for a reevaluation of the standard limits of toxic element concentrations for drinking and irrigation water outlined in the Standing Rules of Water Pollution Control Regulations is evident. Additionally, there is a need to reevaluate the importance of metal mixture interactions and their effect on ecological balance and environmental health. Also, these results might give useful data for the prediction of metal mixture toxicity and identify its associated mechanisms for further study in toxicogenomics. Furthermore, an assessment of multiple metal toxic effects might play a key role in risk evaluation.

5. Conclusion

The results of this study showed that both the stress-specific receptor protein NCCRP1 and the expression of the mito- chondrial superoxide dismutase antioxidant gene (SOD2) were significantly increased. Compared to the control, the results of 5-day exposure showed a dramatic increase in gene expression levels. However, the expression of these genes decreased as the application time was continued. The HSP60 and the HSP70 gene expressions had significantly

DRUG AND CHEMICAL TOXICOLOGY 7

(9)

increased by the 5th day for both the low- and high-concen- trations of the heavy metal mixture. By day 10, the heat shock protein gene expressions (HSP14, HSP60, HSP70) were found to have a significantly higher mean expression level compared to that of the control. In the 5-day exposure trial, the DNA repair XRCC1 gene expression increased by 4.5 and 7.8 times in the low- and high-mixture exposures, respect- ively. The expressions of the XRCC1 and EXO1 genes did not show a significant increase in the long-term exposure groups compared to the control. A significant increase in the BOK and BAX gene expressions, as compared to control, indicates that apoptosis was induced in the cells. Oxidative stress may be a key factor in the toxicity of metal mixtures. At sub- chronic exposures, the balance between oxidative stress and the antioxidant system might be impaired. This would then lead to cell death. The rate of impairment due to oxidative stress and its balance with the antioxidant system is related to the concentration of the mixture and its application period. As the exposure time increased, a gradual response was observed in the low-concentration exposures. However, a short time response was observed after exposure to the high-concentration mixture.

Acknowledgement

This work was supported by the Management Unit of Research Projects of Trakya University under Grant (project ID: TUBAP-2015–179), Edirne, Turkey.

Disclosure statement

The authors declare that there is no conflict of interest.

ORCID

Fulya Dilek G€okalp http://orcid.org/0000-0001-8219-6657 Oguzhan Doganlar http://orcid.org/0000-0003-2654-7269 Zeynep Banu Doganlar http://orcid.org/0000-0002-1365-9897 Utku G€uner http://orcid.org/0000-0003-4135-2486

References

Ahmad, I., et al., 2006. Oxidative stress and genotoxic effects in gill and kidney of Anguilla anguilla L. exposed to chromium with or without pre-exposure to beta-naphthoflavone. Mutation Research, 608 (1), 16–28.

Ahmed, M.K., et al., 2013. Chromium (VI) induced acute toxicity and gen- otoxicity in freshwater stinging catfish, Heteropneustes fossilis.

Ecotoxicology and Environmental Safety, 92, 64–70.

Arakawa, H., et al., 2012. Chromium (VI) induces both bulky DNA adducts and oxidative DNA damage at adenines and guanines in the p53 gene of human lung cells. Carcinogenesis, 33 (10), 1993–2000.

Baer, E.C., et al., 2014. Genome-wide gene expression profiling of acute metal exposures in male zebrafish. Genomics Data, 2, 363–365.

Banasik, A., et al., 2005. Aluminum-induced micronuclei and apoptosis in human peripheral-blood lymphocytes treated during different phases of the cell cycle. Environmental Toxicology, 20 (4), 402–406.

Batool, Z., et al., 2017. Lead Toxicity and Evaluation of Oxidative Stress in Humans. PSM Biological Research, 2 (2), 79–82.

Beyer, J., et al., 2014. Environmental risk assessment of combined effects in aquatic ecotoxicology: A discussion paper. Marine Environmental Research, 96, 81–91.

Birceanu, O., et al., 2008. Modes of metal toxicity and impaired branchial ionoregulation in rainbow trout exposed to mixtures of Pb and Cd in soft water. Aquatic Toxicology., 89 (4), 222–231.

Bishayi, B., and Sengupta, M., 2006. Synergism in immunotoxicological effects due to repeated combined administration of arsenic and lead in mice. International Immunopharmacology, 6 (3), 454–464.

Bourg, E.L., 2001. Oxidative stress, aging and longevity in Drosophila mel- anogaster. FEBS Letters, 498 (2-3), 183–186.

Chen, H., et al., 2004. Chronic inorganic arsenic exposure induces hepatic global and individual gene hypomethylation: implications for arsenic hepatocarcinogenesis. Carcinogenesis, 25 (9), 1779–1786.

Chen, Y.Y., Zhu, J.Y., and Chan, K.M., 2014. Effects of cadmium on cell proliferation, apoptosis, and proto-oncogene expression in zebrafish liver cells. Aquatic Toxicology (Amsterdam, Netherlands), 157, 196–206.

Chowdhury, R., et al., 2010. Arsenic-induced cell proliferation is associ- ated with enhanced ROS generation, Erk signaling and CyclinA expres- sion. Toxicology Letters, 198 (2), 263–271.

Coelho, M.P.M., et al., 2017. Toxicity evaluation of vinasse and biosolid samples in diplopod midgut: heat shock protein in situ localization.

Environmental Science and Pollution Research International, 24 (27), 22007–22017.

Cuypers, A., et al., 2010. Cadmium stress: an oxidative challenge.

Biometals, 23 (5), 927–940.

Dai, Y., et al., 2014. Zebrafish as a model system to study toxicology.

Environmental Toxicology and Chemistry, 33 (1), 11–17.

Deng, X., et al., 2010. Cadmium-induced oxidative damage and protective effects of N-acetyl-L-cysteine against cadmium toxicity in Solanum nig- rum L. Journal of Hazardous Materials, 180 (1-3), 722–729.

Dobrakowski, M., et al., 2017. Oxidative DNA damage and oxidative stress in lead-exposed workers. Human & Experimental Toxicology, 36 (7), 744–754.

Doganlar, O., and Doganlar, Z.B., 2015. Effects of a mixture of volatile organic compounds on Total DNA and gene expression of heat shock proteins in Drosophila melanogaster. Archives of Environmental Contamination and Toxicology, 68 (2), 395–404.

Doganlar, O., Doganlar, Z.B., and Tabakcioglu, K., 2015. Effects of permis- sible maximum-contamination levels of VOC mixture in water on total DNA, antioxidant gene expression, and sequences of ribosomal DNA of Drosophila melanogaster. Environmental Science and Pollution Research International, 22 (20), 15610–15620.

Doganlar, Z.B., Doganlar, O., and Tabakcioglu, K., 2014. Genotoxic effects of heavy metal mixture in Drosophila melanogaster: Expressions of heat shock proteins, RAPD profiles and mitochondrial DNA sequence.

Water Air and Soil Pollution, 225 (9), 1–14.

Doi, T., et al., 2010. Disruption of calreticulin-mediated cellular adhesion signaling in the cadmium-induced omphalocele in the chick model.

Pediatric Surgery International, 26 (1), 91–95.

Exley, C., Chappell, J.S., and Birchall, J.D., 1991. A mechanism for acute aluminium toxicity in fish. Journal of Theoretical Biology, 151 (3), 417–428.

Fernandez-Davila, M.L., et al., 2012. Aluminum-induced oxidative stress and neurotoxicity in grass carp (Cyprinidae-Ctenopharingodon idella).

Ecotoxicology and Environment Safety., 76, 87–92.

Fernandez-Marrero, Y., et al., 2017. The membrane activity of BOK involves formation of large, stable toroidal pores and is promoted by cBID. The FEBS Journal, 284 (5), 711–724.

Flora, S.J.S., Mittal, M., and Mehta, A., 2008. Heavy metal induced oxida- tive stress & its possible reversal by chelation therapy. Indian Journal of Medical Research, 128 (4), 501–523.

Fu, J., et al., 2014. Heavy metals in surface sediments of the Jialu River, China: their relations to environmental factors. Journal of Hazardous Materials, 270, 102–109.

Fu, H., and Boffetta, P., 1995. Cancer and occupational exposure to inor- ganic lead compounds: a meta-analysis of published data.

Occupational and Environmental Medicine, 52 (2), 73–81.

Gao, Q., et al., 2007. cDNA cloning and mRNA expression of heat shock protein 90 gene in the haemocytes of Zhikong scallop Chlamys farreri.

Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 147 (4), 704–715.

(10)

Garcia-Medina, S., et al., 2011. Genotoxic and cytotoxic effects induced by aluminum in the lymphocytes of the common carp (Cyprinus car- pio). Comparative Biochemistry and Physiology Part C: Toxicology and Pharmacology, 153 (1), 113–118.

Gaurav, D., Preet, S., and Dua, K.K., 2020. Chronic cadmium toxicity in rats: treatment with combined administration of vitamins. Journal of Food and Drug Analysis, 18 (6), 464–470.

Ghasemi, H., Rostampour, F., and Ranjbar, A., 2014. The role of oxidative stress in metals toxicity: Mitochondrial dysfunction as a key player.

Galen Medical Journal, 3 (1), 2–13.

Gomez-Olivan, L.M., et al., 2017. Geno- and cytotoxicity induced on Cyprinus carpio by aluminum, iron, mercury and mixture thereof.

Ecotoxicology and Environment Safety., 135, 98–105.

Guha, G., et al., 2011. Antioxidant activity of Lawsonia inermis extracts inhibits chromium(VI)-induced cellular and DNA toxicity. Evidence- Based Complementary and Alternative Medicine, 2011, 1–9.

Hengstler, J.G., 2003. Occupational exposure to heavy metals: DNA dam- age induction and DNA repair inhibition prove co-exposures to cad- mium, cobalt and lead as more dangerous than hitherto expected.

Carcinogenesis, 24 (1), 63–73.

Hughes, M.F., et al., 2011. Arsenic exposure and toxicology: a historical perspective. Toxicological Sciences, 123 (2), 305–332.

Hussainzada, N., et al., 2014. Whole adult organism transcriptional profil- ing of acute metal exposures in male zebrafish. BMC Pharmacology &

Toxicology, 15, 15–15.

IARC, 1993. Interntional agency for research on cancer monographs on the evaluation of carcinogenic risks to humans. Lyon.

Iguchi, M., et al., 2018. Costimulation of murine osteoblasts with inter- feron-c and tumor necrosis factor-a induces apoptosis through down- regulation of Bcl-2 and release of cytochrome c from mitochondria.

Mediators of Inflammation, 2018, 3979606.

Jadhav, S.H., et al., 2007a. Induction of oxidative stress in erythrocytes of male rats subchronically exposed to a mixture of eight metals found as groundwater contaminants in different parts of India. Archives of Environmental Contamination and Toxicology, 52 (1), 145–151.

Jadhav, S.H., et al., 2007b. Effects of subchronic exposure via drinking water to a mixture of eight water-contaminating metals: a biochem- ical and histopathological study in male rats. Archives of Environmental Contamination and Toxicology, 53 (4), 667–677.

Jadhav, S.H., et al., 2007c. Immunosuppressive effect of subchronic exposure to a mixture of eight heavy metals, found as groundwater contaminants in different areas of India, through drinking water in male rats. Archives of Environmental Contamination and Toxicology, 53 (3), 450–458.

Jung, D., et al., 2003. Immunotoxicity of co-exposures to heavy metals:

in vitro studies and results from occupational exposure to cadmium, cobalt and lead. Excli Journal, 2 (2003), 31–44.

Kanev, M. O., 2016. Oxidative Stress Response of Five Different Mixed Metals on Adult Zebra Fish (Danio rerio, Hamilton 1822). (Master).

Republic of Turkey Trakya University, Institute of Science, Master Thesis.

Komjarova, I., and Blust, R., 2009. Multimetal interactions between Cd, Cull, Ni, Pb, and Zn Uptake from water in the Zebrafish Danio rerio.

Environmental Science & Technology, 43 (19), 7225–7229.

Komjarova, I., and Bury, N.R., 2014. Evidence of common cadmium and copper uptake routes in zebrafish Danio rerio. Environmental Science &

Technology, 48 (21), 12946–12951.

Kostova, I., and Balkansky, S., 2013. Metal complexes of biologically active ligands as potential antioxidants. Current Medicinal Chemistry, 20 (36), 4508–4539.

Krishnaraj, J., et al., 2017. Exposure to welding fumes activates DNA dam- age response and redox-sensitive transcription factor signalling in Sprague-Dawley rats. Toxicology Letters, 274, 8–19.

Leonard, S.S., Harris, G.K., and Shi, X., 2004. Metal-induced oxidative stress and signal transduction. Free Radical Biology & Medicine, 37 (12), 1921–1942.

Lokke, H., Ragas, A.M.J., and Holmstrup, M., 2013. Tools and perspectives for assessing chemical mixtures and multiple stressors. Toxicology, 313 (2-3), 73–82.

Lushchak, O.V., et al., 2008. The effect of potassium dichromate on free radical processes in goldfish: possible protective role of glutathione.

Aquatic Toxicology (Amsterdam, Netherlands), 87 (2), 108–114.

McDonald, D. G., Reader, J. P., and Dalziel, T. R. K., 1989. The combined effects of pH and trace metals on fish ionoregulation. Boston:

Cambridge University Press.

Nandi, D., Patra, R.C., and Swarup, D., 2005. Effect of cysteine, methio- nine, ascorbic acid and thiamine on arsenic-induced oxidative stress and biochemical alterations in rats. Toxicology, 211 (1-2), 26–35.

Nita, M., and Grzybowski, A., 2016. The role of the reactive oxygen spe- cies and oxidative stress in the pathomechanism of the age-related ocular diseases and other pathologies of the anterior and posterior eye segments in adults. Oxidative Medicine and Cellular Longevity, 2016, 1–23.

Norwood, W.P., et al., 2003. Effects of metal mixtures on aquatic biota: a review of observations and methods. Human and Ecological Risk Assessment, 9 (4), 795–811.

Official Newspaper. 1991. Republic of Turkey, Ministry of Environment and Forest, Communique on technical procedures of water pollution control regulation, January/7/1991 No: 20748. Turkey: Official Newspaper.

Official Newspaper. 2013. Turkish Republic Health Institution, Regulations on waters intended for human consumption, March/7/2013 No:

28580.

Official Newspaper. 2017. Republic of Turkey, Ministry of Environment and Forest, Communique on technical procedure of wastewatre treatment, September/17/2017.

Olvera-Nestor, C.G., et al., 2016. Biomarkers of cytotoxic, genotoxic and apoptotic effects in Cyprinus carpio exposed to complex mixture of contaminants from hospital effluents. Bulletin of Environment Contamination and Toxicology, 96 (3), 326–332.

Pierron, F., et al., 2014. Effect of low-dose cadmium exposure on DNA methylation in the endangered European eel. Environmental Science &

Technology, 48 (1), 797–803.

Roh, J.Y., Lee, J., and Choi, J., 2006. Assessment of stress-related gene expression in the heavy metal-exposed nematode Caenorhabditis ele- gans: a potential biomarker for metal-induced toxicity monitoring and environmental risk assessment. Environmental Toxicology and Chemistry, 25 (11), 2946–2956.

Rossman, T.G., Uddin, A.N., and Burns, F.J., 2004. Evidence that arsenite acts as a cocarcinogen in skin cancer. Toxicology and Applied Pharmacology, 198 (3), 394–404.

Sahin, K., Sahin, N., and Kucuk, O., 2003. Effects of chromium, and ascor- bic acid supplementation on growth, carcass traits, serum metabolites, and antioxidant status of broiler chickens reared at a high ambient temperature (32 degrees C). Nutrition Research, 23 (2), 225–238.

Sanders, T., et al., 2009. Neurotoxic effects and biomarkers of lead expos- ure: a review. Reviews on Environmental Health, 24 (1), 15–45.

Scheil, V., et al., 2010. Embryo development, stress protein (Hsp70) responses, and histopathology in zebrafish (Danio rerio) following exposure to nickel chloride, chlorpyrifos, and binary mixtures of them.

Environmental Toxicology and Risk Assessment, 25 (1), 83–93.

Seppola, M., Robertsen, B., and Jensen, I., 2007. The gene structure and expression of the non-specific cytotoxic cell receptor protein (NCCRP- 1) in Atlantic cod (Gadus morhua L.). Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 147 (2), 199–208.

Shaikh, Z.A., Vu, T.T., and Zaman, K., 1999. Oxidative stress as a mechan- ism of chronic cadmium-induced hepatotoxicity and renal toxicity and protection by antioxidants. Toxicology and Applied Pharmacology, 154 (3), 256–263.

Sharma, B., Singh, S., and Siddiqi, N.J., 2014. Biomedical implications of heavy metals induced imbalances in redox systems. BioMed Research International, 2014, 640754.

Shive, H., 2013. Zebrafish models for human cancer. Veterinary Pathology, 50 (3), 468–482.

Stankeviciute, M., et al., 2017. Genotoxicity and cytotoxicity response to environmentally relevant complex metal mixture (Zn, Cu, Ni, Cr, Pb, Cd) accumulated in Atlantic salmon (Salmo salar). Part I: importance of exposure time and tissue dependence. Ecotoxicology, 26 (8), 1051–1064.

DRUG AND CHEMICAL TOXICOLOGY 9

(11)

Stankeviciute, M., et al., 2018. Responses of biomarkers in Atlantic salmon (Salmo salar) following exposure to environmentally relevant concen- trations of complex metal mixture (Zn, Cu, Ni, Cr, Pb, Cd). Part II.

Ecotoxicology, 27 (8), 1069–1086.

Tao, S., et al., 1999. Synergistic effect of copper and lead uptake by fish.

Ecotoxicology and Environmental Safety, 44 (2), 190–195.

Tashakor, A., et al., 2019. A new split-luciferase complementation assay identifies pentachlorophenol as an inhibitor of apoptosome formation.

FEBS Open Bio, 9 (7), 1194–1203.

Tavakol, H.S., et al., 2015. Protective effects of green tea on antioxidative biomarkers in chemical laboratory workers. Toxicology and Industrial Health, 31 (9), 862–867.

Templeton, D.M., and Liu, Y., 2010. Multiple roles of cadmium in cell death and survival. Chemico-Biological Interactions, 188 (2), 267–275.

Thevenod, F., 2009. Cadmium and cellular signaling cascades: to be or not to be?. Toxicology and Applied Pharmacology, 238 (3), 221–239.

USEPA. 2007. Unites states environmental protection agency/framework for metals risk assessment. Washington DC.

Valko, M., Morris, H., and Cronin, M.T., 2005. Metals, toxicity and oxidative stress. Current Medicinal Chemistry, 12 (10), 1161–1208.

Ventura-Lima, J., et al., 2009. Effects of arsenic (As) exposure on the anti- oxidant status of gills of the zebrafish Danio rerio (Cyprinidae).

Comparative Biochemistry and Physiology Part C: Toxicology &

Pharmacology, 149 (4), 538–543.

Waalkes, M.P., 2000. Cadmium carcinogenesis in review. Journal of Inorganic Biochemistry, 79 (1-4), 241–244.

Wang, B., et al., 2015. Copper-induced tight junction mRNA expression changes, apoptosis and antioxidant responses via NF-jB, TOR and Nrf2 signaling molecules in the gills of fish: preventive role of argin- ine. Aquatic Toxicology, 158, 125–137.

Wang, F.S., et al., 2011. Heat shock protein 60 protects skeletal tissue against glucocorticoid-induced bone mass loss by regulating osteo- blast survival. Bone, 49 (5), 1080–1089.

Whittaker, M.H., et al., 2011. Exposure to Pb, Cd, and As mixtures potenti- ates the production of oxidative stress precursors: 30-day, 90-day, and 180-day drinking water studies in rats. Toxicology and Applied Pharmacology, 254 (2), 154–166.

Wu, X., et al., 2016. A review of toxicity and mechanisms of individual and mixtures of heavy metals in the environment. Environmental Science and Pollution Research International, 23 (9), 8244–8259.

Referanslar

Benzer Belgeler

The coalitions like the RPP-NSP, the RPP-RRP-DemP-independents, the TPP- SDPP/RPP in 1995 the were the last remaining options. Their target was not carrying out common

H- score analysis revealed that AQP1 and AQP4 immunoreactivity significantly increased in heart tissues of old mice compared with those of young mice (p&lt;0.001).. In addition,

Son olarak, etkileşimci liderlik ve örgütsel yapının tüm boyutları arasında orta düzeyde pozitif ve anlamlı bir ilişki tespit edilirken, etkileşimci

Kayahan Özgül, ön söz mahiyetinde- ki “Başlarken”de Namık Kemal’e atfedilen vasıfları, Namık Kemal’in bizzat yüklendiği fikirleri ve bunlarla birlikte bir

© Copyright 2020 by Bosphorus Medical Journal - Available online at http://www.bogazicitipdergisi.com Tip II Diabetes Mellituslu Hastalarda Düşük Molekül Ağırlıklı Heparinin

In the present study, although there were no histopathologically significant changes in the testes of male zebrafish, there were significant differences between

In another study examining the histopathological changes of 2,4-dichlorophenoxyacetic acid in zebrafish intestine tissue, findings such as hyperplasia in goblet

vs: vesicle. Four mg/L TiO 2 exposure group. Severe vacuolization at follicular cell, degeneration of pore and microvilli structures in zona radiata, myelin like structure,