• Sonuç bulunamadı

View of Determination of Suitable Candidate Genes as Endogenous Control for Gene Expression Analysis in Local Capsicum Annuum MC11

N/A
N/A
Protected

Academic year: 2021

Share "View of Determination of Suitable Candidate Genes as Endogenous Control for Gene Expression Analysis in Local Capsicum Annuum MC11"

Copied!
7
0
0

Yükleniyor.... (view fulltext now)

Tam metin

(1)

Research Article

Determination of Suitable Candidate Genes as Endogenous Control for Gene Expression

Analysis in Local Capsicum Annuum MC11

Marina Mokhtar1, Raja Farhana Raja Khairuddin2, Nurhaida Kamaruddin3,Jameel R Al-Obaidi4,

RofinaYasmin Othman5

1,2,3,4Department of Biology, Faculty of Science and Mathematics, Universiti Pendidikan Sultan Idris, Tanjong Malim 35900, Perak, Malaysia

5Faculty of Science, Institute of Biological Sciences, University of Malaya, Kuala Lumpur, Malaysia [email protected]

Article History: Received: 10 November 2020; Revised: 12 January 2021; Accepted: 27 January 2021;

Published online: 05 April 2021

Abstract: Quantitative real-time polymerase chain reaction (qRT-PCR) is one of the most common methods for gene

expression studies. Data normalization based on reference genes is essential for qRT-PCR assays. This study identifies suitable reference genes for local chilli, Capsicum annuum var MC11 under incident of Cucumber mosaic virus infection. Six candidate genes actin, tub, EF1α, GAPDH, TEF1α and 18SrRNA and three validated Capsicum reference genes UBI-3 ref,

β-tub ref and gapdhref were tested against five chilli plant parts stem, shoot, leave, flower and root. The PCR/qRT-PCR results

demonstrate only five candidate references genes actin, EF1α, GAPDH, 18SrRNA, and TEF1α that show specific single band of amplicon, without primer dimers and at the targeted sizes. Through qRT-PCR, GAPDH gives single peak in dissociation curve in all plant parts used further fulfilling the characteristic of reference genes.Previous work on validation of reference genes in pepper shows that only UBI-3 suits to C. annuum var MC11 infected CMV, thus we suggest that GAPDH has a potential to be a validated reference gene for C. annuum var MC11 and can be used together UBI-3 for the purpose of data normalization.

Keywords:Capsicum annuum, endogenous control, Cucumber mosaic virus. 1. Introduction

Cucumber Mosaic Virus (CMV) is an economically important plant pathogen with a broad host range more than 1000 plant species(Jacquemond, 2012). It shares with tomato aspermy virus (TAV) and peanut stunt virus (PSV) under genus Cucumovirus, in the family of Bromiviridae. The CMV genome is organized into three single-stranded messenger –sense genomic RNAs namely as RNA1, RNA 2 and RNA 3 in the order of decreasing size. Many strains of CMV induce a generic light green/dark-green mosaic; however, some strains induce other symptoms, such as chlorosis, stunting, epinasty, necrotic lesions(Divéki, Salánki, & Balázs, 2004).

Similar to other plant-viral interaction, early detection of CMV particles in infected plants can be achieved through quantitative real-time polymerase chain reaction (qRT-PCR)(Guan et al., 2017). qRT-PCR is the most common method for either characterising or confirming gene expression patterns as well as comparing mRNA levels across different sample populations due to its high sensitivity, accuracy, specificity, and reproducibility (Nolan, Hands, & Bustin, 2006). qRT-PCR requires a series of two enzymatic reactions, used of reverse transcriptase in the productions of complementary DNA (cDNA) followed by amplifying target gene using DNA polymerase in PCR. qRT-PCR can detect exceptionally low quantities of target transcript with remarkably high specificity due to a high temperature used during annealing of specific primer to targets sequence during PCR (Guénin et al., 2009).

The normalisation of the expression level of the target gene needs the use of a stably expressed gene, called 'reference'(Sinha, Sharma, & Singh, 2019). The reference gene is presumed to be representative of the cDNA concentration in each sample and subject to the same errors during cDNA preparation as the target gene(s)(Bustin et al., 2009). Several genes that are commonly used as reference genes, such as Glyceraldehydes-3-Phosphate Dehydrogenase (GAPDH), 18S ribosomal RNA (18srRNA), Elongation Factor 1-α (EF1)and Actin (ACT).These genes are involved in basic and ubiquitous cellular process glycolytic metabolism, ribosome biosynthesis, cytoskeleton constitution and protein folding(Liu et al., 2012).

An ideal reference gene which is also called as endogenous reference genes or housekeeping genes will demonstrate a consistent level of expression regardless of tissues differences, experimental conditions, or treatments (Deng et al., 2019; Huang et al., 2017). However, it is evidenced that the transcription levels of these reference genes can be unstable in response to the different experimental conditions or different tissue types (Liu et al., 2012). The use of reference genes that are neither valid nor stable can have a significant impact on the

(2)

Malaysia has wide varieties of chilli such as hot chilli, red chilli, bird eye, sweet pepper, Kulai, and MC 11. The variety used in this study was C. annuum MC11. To best of our knowledge, there is no reported endogenous reference genes used for study on the MC11 variety. Thus, this work is designed to validate previous four putative reported genes from different plant organs for future gene expression analysis in chilli analysis to involve gene regulation specifically those with chilli diseases. Initially, the primers were designed targeted for six groups of genes: actin, 18s ribosomal RNA, glyceraldehyde-3-phosphate dehydrogenase, ubiquitin, elongation factor 1-alpha, and translation elongation factor 1a(Wan et al., 2011).

Twenty-two sets of primer were designed, synthesized, and tested through PCR. However, none of candidate genes for ubiquitin qualify for specific amplicons. PCR products were verified in 1.5% agarose gel and only five designated primers for actin, 18s ribosomal RNA, glyceraldehyde-3-phosphate dehydrogenase, elongation factor 1-alpha, and translation elongation factor 1a for demonstrating specific amplicons with correct band size as presented in Figure 1(a).Three sets of primers from published work on C. annuum (Wan et al., 2011) were also verified, β-tub*, gap* and UBI-3* based on their most stably expression profiles across treatment and tissues.

2. Materials and Methods Plant material

Seeds of C. annuum var MC11 were germinated on the seedling tray. Once the first pair of true leaves appear, the seedlings were transplanted into individual pots. The entire germination and growth processes were conducted in a Plant Biotechnology Facility (PBF), University Malaya. Growth conditions were set to 25 ⁰C and 75 % humidity.Chili plants subjected to virus-challenge were mechanically inoculated usingcarburandum. Young leaves with clear CMV symptoms from diseased plants were prepared as inoculum in phosphate buffer (1:10 w/v). The trace of inoculum was rinse off 20 minutes after inoculation. Samples of the root, stem, leave, flower, and shoot from control and CMV infected plants were harvested, snap cooled in liquid nitrogen and stored at -80°C for total RNA extraction. Three biological replicates were arranged for future analysis.

Recovery of RNA and cDNA synthesis

Total RNA was isolated from fine ground tissue using NucleoSpin® RNA Plant (Macherey-Nagel, Germany) according tothe manufacturer’s protocol. The fozen tissues was treated with Buffer RA1, vortexed and filtered through NucleoSpin® Filter at 11, 000 x g for 1 minute. The filtrate was carefully transferred into a fresh tube followed by additional and mixing with 70% ethanol. Then, the sample was transferred into NucleoSpin® RNA Plant Column placed in a 2-mL collection tube, centrifuged at 11, 000 x g for 30 seconds. The flow-through was discarded, and 350 mL of MDB was added to the column followed by centrifugation 11, 000 x g for 1 minute. Next, Buffer RAW2 was applied as first step washing followed by twice of second step washing using Buffer RA3.

Each washing steps was accompanied with centrifugation at the 11, 000 x g for 30 seconds. Final centrifugation at 11, 000 x g was performed for 2 minutes prior elution using RNAse-free water performed at 11, 000 x g for 1 minute. The purity and concentration of isolated RNA weredetermined using NanoDrop™ 2000 (Thermo Scientific, USA) spectrophotometer.The integrity of RNA was confirmed on 1 % agarose gel electrophoresis.

Total RNA (1.0 µg) was used for reverse transcription with QuantiTect® Reverse Transcription Kit (Qiagen, Germany) in a 20 µl reaction volume according to the manufacturer’s protocol.

Primer design and RT-qPCR conditions

Five candidates’ genes were selected to be normalized and validated forqRT-PCR analysis, ACT, 18s, GAP, EF1α and TEF1α on 5 plant organs, root, stem, leaf, shoot and flower as presented in Table 1. Two internal genes of CMV, MP and CP were used to verify the presence of CMV in both controlled and CMV-infected chilli plants. The sequences were obtained from GenBank and primer sequences were designed using Primer3 (http:bioinfo.ut.ee/primer3-0.4.0/). Each primer set was expected to produce amplicon size between 170 to 200 bp. Three sets of primer were prepared for each targeted reference gene. All amplicons were analysed in 1.5 % agarose and prDNA sequence before qRT-PCR. The best set was identified based on disassociation curve

(3)

RT-qPCR was carried out on ABI prism 7500 Fast Real-time PCR system using Power SYBR® Green Master Mix (Applied Biosystems™, USA). The 20 µl reaction mixture contains 10 µl SYBR Green Master Mix [2×], 2 µl cDNA, 0.8 µl for each forward and reverses primer and 6.4 µl ddH2O. Amplification programmes were set to 95⁰ C for 30s, 40 cycles at to 95⁰ C for 5s, 51⁰ C for 15s, 72⁰ C for 30s.To draw the melting curve, the PCR product was heated from 65⁰ C to 95⁰ C (0.5⁰ C/5s), and the raw Ct values were obtained. Each qRT-PCR reaction was conducted in a technical of four replicates which brought to preparation of 600 reactions for the whole work, not including negative controls. The slope of the standard curve generated through serial 10-fold dilutions of the cDNA samples was used to calculate the amplification efficiency for each candidate gene.

Table 1.Selected candidate reference genes for reference validation, primers, and amplicon characteristics Gene symbol Gene name Accession number Length (bp) Primer sequences 5'-3'

ACTIN Actin GQ339766.1 180 F: GGAAAAGCTTGCCTATGTGG

R: CCTGCAGCTTCCATACCAAT GAP Glyceraldehyde-3 phosphate dehydrogenase AJ246009.1 185 F: ACCGGAGTTTTTGTGGACAG R: GGAGCAAGACAGTTGGTGGT

EF1α Elongation factor 1 alpha AY496125.1 197 F: GCCTCAAACTCCAAGGATGA R: GGCTCCTTCTCGAGTTCCTT TEF1α Thyrotroph embryonic factor AF242732.1 200 F: TCCCCTTCGTCCCTATTTCT R: ACGACCAACAGGGACAGTTC 18s 18srRNA EF564281.1 183 F: GTCGTCTCGTCCCTTCTGTC R: TCATTACTCCGATCCCGAAG

β-tub* Beta tubulin ref EF495259.1 167 F: GAGGGTGAGTGAGCAGTTC

R: CTTCATCGTCATCTGCTGTC gap* Glyceraldehyde-3 phosphate dehydrogenase ref AJ246013.1 276 F: ATGATGATGTGAAAGCAGCG R: TTTCAACTGGTGGCTGCTAC

UBI-3* Ubiquitin ref AY486137.1 204 F: TGTCCATCTGCTCTCTGTTG

R: CACCCCAAGCACAATAAGAC * reference genes from Wan et al. (2011).

3. Results and Discussion

The aim of this work was to identify specific endogenous reference genes for local C. annuuminduced with CMV.Chilli seeds sowed in sedling tray were let grow until they reached two-true leaves stages as presented in Figure 1(a). The seddlingswere transferred into individual polybags for to grow and insect-sticky traps were applied throughought the study as demonstrates in Figure 1(b).

(4)

Figure 1.0.C. annuum plants. (a) Seedlings at the stage of two-true leaves in seedling tray. (b). Chilli plants

in individual polybag guarded with sticky traps

The chilli plants were then proceed with for virus challenge experiment CMV. CMV infected demonstrates light-green mosaic and mottling on younger leaves due to lost of chlorphyll pigments in the infected plants (Figure 2a) and vein bending (Figure 2b).

Figure 2.CMV symptoms in C. annuum var MC11.(a) Formation of light-green mosaic on leaves. (b)

Leave with light-green and mosaic vein bending.

The purity and integrity of extracted RNA was determined using NanoDrop™ 2000 and in 1.5% agarose gel electrophoresis prior synthesis of cDNA. The cDNA later was used to evaluate on twenty two pairs of candidate reference genes. There are 5 reference genes which gives single product of expected length as presented in Figure 3, actin, EF1α, GAPDH, 18srRNA and TEF 1α with estimated size fragments of 180 bp, 197 bp, 185 bp, 183 bp and 200 bp respectively. Moreover, there is no primer dimers observes contaminating the PCR products. Each amplicon produced represent their respective estimated size as predicted in Table 1. PCR data in Figure 3 also reflects on the cDNA used is of good quality and free from genomic DNA contamination. It also demonstrates cDNA synthesized suitable for the purpose of qrt-PCR in later stage.

As earlier mentioned, three published reference genes forC. annuum(Wan et al, 2011) were also verified, β-tub*, gap* and UBI-3*. They were selected based on their stable expressions in their experimental conditions contributed by abiotic stress and hormones treatment. While their work reported that gap* and UBI-3* work best in all tissues, our findings gap* did not produce any amplicons in PCR (data not shown). However, β-tub*, and UBI-3* gives specific amplicons and UBI-3* was further tested in qrt-PCR. Three internal genes of CMV, MP,CPand CMV2b were used to verify the presence of CMV in both wild type and tested chilli plantsand presented as in Figure 3(b).

(5)

Figure 3.PCR confirmation in 1.5% agarose.(a) Candidate endogenous control genes primer specificity

test on Capsicum annuumvar MC11

Lane 1: actin, lane 2: EF1α; lane 3: GAPDH; lane 4: 18srRNA, lane 5:TEF 1α. 100 bp: 100bp ladder marker (Fermentas) (b) Candidate genes for CMV. Lane 1: coat protein, lane 2: movement protein, lane 3: CMV2b.100 bp: 100bp ladder marker (Fermentas).

Further verification on UBI-3* and GAPDH primers in qRT-PCR produce melting curve with single clean peak as presented in Figure 4(a) and 4(b) respectively. Primers for ACTIN, 18s, EF1αandTEF1α will also be tested against all five plant organs to obtain their melting curve plot.

Figure 4. Melting curves of two candidate reference genes show a simple peak. (a) ubiquitin (b) GAPDH.

Continuoues search for stably expressed endogeneous reference on the same plant has takes place in soybean (Glycine max) (Cheng et al., 2017; Gao et al., 2017); in rice (Oryza sativa)(Ding et al., 2004; Kumar, Das, & Sarmah, 2018) and also in tobacco (Nicotiana tabacum) (Baek, Yoon, & Palukaitis, 2017; Liu et al., 2012). Among common factor that contributes is due to the difference in an experimental setup, exposure to pathogens or abiotic stress and developmental stages. The choices of endogenous reference for this work are commonly used based on their involvement in the maintenance of cell structure or metabolism (Czechowski, et. al., 2005). Their universal usage can be found in rice (Kumar et al., 2018), tobacco (Liu et al., 2012), yam (Zhao et al., 2016) with the length of amplicons between 120 to 200 bp. The necessity of designing and validating for local chilli endogenous reference genes is because of the different variety of chilli and experimental design compares

(6)

4. Conclussion

Five candidate reference genes for C. annuum MC11 in this work, ACTIN, 18s, GAPDH, EF1α and TEF1α demonstrate specific amplicon with correct estimated sizes. Melting curve of GAPDH in qRT-PCR gives a simple, clean peak. Futher work need to be carried out on verification of ACTIN, 18s, EF1α and TEF1α melting curve before testing on their expression stability across all tissues in both control and CMV infected chilli plants.

5. Acknowledgement

The authors would like to extend their gratitude to the Research Management and Innovation Centre (RMIC), Universiti Pendidikan Sultan Idris (UPSI) for the University Research Grant (code: 2016-0191-102-01) helped to fund the research.

References

6. Baek, E., Yoon, J. Y., & Palukaitis, P. (2017). Validation of reference genes for quantifying changes in gene expression in virus-infected tobacco. Virology, 510, 29–39. https://doi.org/10.1016/j.virol.2017.06.029

7. Bustin, S., Benes, V., Garson, J., Hellemans, J., Huggett, J., Kubista, M., … Wittwer, C. (2009). The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. https://doi.org/10.1373/clinchem.2008.112797

8. Cheng, Y., Pang, X., Wan, H., Ahammed, G. J., Yu, J., Yao, Z., … Zhou, G. (2017). Identification of optimal reference genes for normalization of qPCR analysis during pepper fruit development. Frontiers in Plant Science, 8(June), 1–14. https://doi.org/10.3389/fpls.2017.01128

9. Czechowski, T., Stitt, M., Altmann, T., Udvardi, M., & Scheible, W. (2005). Genome-wide identification and testing of superior reference genes for transcript normalization in arabidopsis. Plant Physiology. American Society of Plant Biologists. https://doi.org/10.1104/pp.105.063743

10. Deng, T., Huang, W., Ren, J., Ma, X., Ge, Y., & Chen, Y. (2019). Verification and applicability of endogenous reference genes for quantifying GM rice by digital PCR. Analytical Biochemistry, 587. https://doi.org/10.1016/j.ab.2019.113442

11. Ding, J., JIA, J., Yang, L., WEN, H., Zhang, C., LIU, W., & ZHANG, D. (2004). Validation of a rice specific gene, sucrose phosphate synthase, used as the endogenous reference gene for qualitative and real-time quantitative PCR detection of transgenes. Journal of Agricultural and Food Chemistry, 52(11), 3372–3377. https://doi.org/10.1021/jf049915d

12. Divéki, Z., Salánki, K., & Balázs, E. (2004). The necrotic pathotype of the Cucumber mosaic virus (CMV) Ns strain is solely determined by amino acid 461 of the 1a protein. Molecular Plant-Microbe Interactions, 17(8), 837–845. https://doi.org/10.1094/MPMI.2004.17.8.837

13. Gao, M., Liu, Y., Ma, X., Shuai, Q., Gai, J., & Li, Y. (2017). Evaluation of reference genes for normalization of gene expression using quantitative RT-PCR under aluminum, cadmium, and heat stresses in soybean. PLoS ONE, 12(1), 168965. https://doi.org/10.1371/journal.pone.0168965

14. Guan, Z., Wu, D., Song, A., Chen, F., Chen, S., & Fang, W. (2017). A highly sensitive method for the detection of Chrysanthemum virus B. Electronic Journal of Biotechnology, 26, 64–68. https://doi.org/10.1016/j.ejbt.2017.01.003

15. Guénin, S., Mauriat, M., Pelloux, J., Van Wuytswinkel, O., Bellini, C., & Gutierrez, L. (2009). Normalization of qRT-PCR data: The necessity of adopting a systematic, experimental conditions-specific, validation of references. Journal of Experimental Botany, 60(2), 487–493. https://doi.org/10.1093/jxb/ern305

16. Gutierrez, L., Mauriat, M., Guénin, S., Pelloux, J., Lefebvre, J.-F., Louvet, R., … Van Wuytswinkel, O. (2008). The lack of a systematic validation of reference genes: A serious pitfall undervalued in reverse transcription-polymerase chain reaction (RT-PCR) analysis in plants. Plant Biotechnology Journal, 6(6), 609–618. https://doi.org/10.1111/j.1467-7652.2008.00346.x

17. Huang, Y., Tan, H., Yu, J., Chen, Y., Guo, Z., Wang, G., … Diao, Y. (2017). Stable internal reference genes for normalizing real-time quantitative pcr in baphicacanthus cusia under hormonal stimuli and uv irradiation, and in different plant organs. Frontiers in Plant Science, 8, 668. https://doi.org/10.3389/fpls.2017.00668

18. Jacquemond, M. (2012). Cucumber Mosaic Virus. In Advances in Virus Research (Vol. 84, pp. 439– 504). Academic Press Inc. https://doi.org/10.1016/B978-0-12-394314-9.00013-0

(7)

20. Liu, D., Shi, L., Han, C., Yu, J., Li, D., & Zhang, Y. (2012). Validation of Reference Genes for Gene Expression Studies in Virus-Infected Nicotiana benthamiana Using Quantitative Real-Time PCR. PLoS ONE, 7(9), e46451. https://doi.org/10.1371/journal.pone.0046451

21. Nolan, T., Hands, R., & Bustin, S. (2006). Quantification of mRNA using real-time RT-PCR. Nature Protocols, 1(3), 1559–1582. https://doi.org/10.1038/nprot.2006.236

22. Sinha, R., Sharma, T. R., & Singh, A. K. (2019). Validation of reference genes for qRT-PCR data normalisation in lentil (Lens culinaris) under leaf developmental stages and abiotic stresses. Physiology and Molecular Biology of Plants, 25(1), 123–134. https://doi.org/10.1007/s12298-018-0609-1

23. Wan, H., Yuan, W., Ruan, M., Ye, Q., Wang, R., Li, Z., … Yang, Y. (2011). Identification of reference genes for reverse transcription quantitative real-time PCR normalization in pepper (Capsicum annuum L.). Biochemical and Biophysical Research Communications, 416(1–2), 24–30. https://doi.org/10.1016/j.bbrc.2011.10.105

24. Zhao, X., Zhang, X., Guo, X., Li, S., Han, L., Song, Z., … Li, M. (2016). Identification and Validation of Reference Genes for qRT-PCR Studies of Gene Expression in Dioscorea opposita. BioMed Research International, 2016. https://doi.org/10.1155/2016/3089584

Referanslar

Benzer Belgeler

These lateral and vertical heterostructures have inhomogeneous magnetic moment configurations due to p−d hybridization; in both sides of the junction, chalcogen atoms have

Similarly, correlation of mechanical noise can be calculated by using the generalized Nyquist theorem which states that the current noise correlation between two ports in an

It is for sure that the rapid change in the Congo from a dependent colony to a free state, did not fit in with the improvement of the perspectives of some Belgians, which

Yazarın babası olan tefsir âlimi ve Arapça üstadı Hüseyin Küçükkalay Hoca haricinde Mehmet Genç ve Ahmet Tabakoğlu hocalar özellikle İktisat Tarihi camiasında

Using the total momentum shift operator to construct the perturbed many- body Hamiltonian and ground state wave function the second derivative of the ground state energy with respect

The MTT test did not indicate a significant growth inhibition in ZF4 cells following rapamycin treatment, however, rapamycin was observed to significantly downregulate zebrafish

gönderilen balgam örneğinden yapılan gram boyalı preperatta her alanda 25’ten fazla polimorfonükleer lökosit ve 10’dan az yassı epitel hücresi ile birlikte

Otelcilik ve Turizm Meslek Lisesi Öğretmenlerinden toplanan veriler üzerinde yapılan istatistiksel analizler sonucunda, Otelcilik ve Turizm Meslek Lisesi