• Sonuç bulunamadı

Evolution and Medicine

N/A
N/A
Protected

Academic year: 2021

Share "Evolution and Medicine"

Copied!
50
0
0

Yükleniyor.... (view fulltext now)

Tam metin

(1)
(2)

Personalized genomics

(3)
(4)
(5)
(6)

Random Drift and Natural selection

Darwin suggested the following:

• Organisms compete for finite resources. • Organisms with favorable characteristics are more likely to reproduce, leading to fixation of favorable mutations (Natural selection). • Over time, the accumulation of many changes suitable to an environment leads to speciation if there is isolation.

Kimura (1960s) observed

• Most mutations are selectively neutral! • They drift in the population, eventually getting eliminated, or fixed by random chance.

Three outcomes of mutations

(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)

Single Nucleotide Polymorphisms

(15)

Single Nucleotide Polymorphisms

Infinite Sites Assumption: Each site mutates at most once

(16)

Variable Number of Tandem Repeats (VNTR)

Minisatellites: 10-60 bp long canonic sequences, often repeated 5-50 times

Microsatellites = Short Tandem Repeats (STR): 2-6 bp

GCTAGATCATCATCATCATTGCTAG GCTAGATCATCATCATTGCTAGTTA

GCTAGATCATCATCATCATCATTGC GCTAGATCATCATCATTGCTAGTTA

GCTAGATCATCATCATTGCTAGTTA

GCTAGATCATCATCATCATCATTGC

4 3 5 3 3 5

Copy number variations

6 individuals compared for a certain locus that contains ATC repeats

(17)
(18)

Allelic combinations

(19)
(20)
(21)
(22)

DNA

Poliformik lokus

karşılaştırması

(23)

DNA Fingerprint

(24)

A forensic test laboratory uses a set of 13 different microsatellite markersin forensic analysis. 13 sets of specific PCR primers are used to determine the allele present in the test sample for each marker. The marker used, the number of alleles at each marker and the probability of obtaining a random match for a marker is shown. How often would you expect an individual to be mis-identified if all 13 markers are analyzed Locus No. of alleles probability of

(25)
(26)

EcoRI map for the region in one individual Same region of a second individual may appear as 3kb 4kb GAATTC GAATTC GAATTC 7kb GAGTTC GAATTC GAATTC Variation#1 GAATTC Variation#2 GAGTTC Marker samples EcoRI 1 2

(27)
(28)

Example for some Polymorphic Serum Protein Groups

a,-antitrypsin PIM1, PIM2, PIM3,

(29)
(30)

Polymorphic sites of chromosomes

Due to heterochromatin regions (1; 9; 16)

(31)
(32)

What is evolution?

The change in the genetic

make-up of a species over

time

(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)

MICROEVOLUTION LEADS TO

(48)

SPECIES FORMATION

(49)
(50)

Referanslar

Benzer Belgeler

Belediyeler tarafından yapı kullanma izin belgesi verilen ya- pıların 2016 yılının ilk üç ayında bir önceki yıla göre, bina sa- yısı %2,6, yüzölçümü %2,2, değeri

Autoimmune thyroid disease / Otoimmün tiroid hastalığı, 52 Benign bone tumours / Benign kemik tömürleri, 128 Bicanalicular silicone intubation / Bikanaliküler stent entubasyonu,

In our study, when each patient and control group was analyzed for the genotype distribution and allele frequency of PAI-1 4G5G, the genotype frequency was determined to be 4G4G

Results of these genomic studies showed that amount of DHFR and whether the change of stability or the change on catalysis rate of enzyme is important to become

44 Table 4.3.1 The effect of Zn supply (+Zn = 2 mg kg -1 soil) on leaf symptoms of Zn deficiency, shoot dry weight, and Zn efficiency ratio of the 23 most NaCl tolerant and the

The mitochondrial genetic differences among nesting colonies supported the nest site fidelity of females while microsatellites did not show genetic structuring which

The goal of the current survey was to ascertain the allele and genotype frequencies of ABCC2 1249G>A polymorphism in a Turkish population and to compare the findings obtained

Domestic goat and sheep populations maintained for many generations with small numbers of male and female parents, or declining in total numbers, not only endure accumulated