• Sonuç bulunamadı

A New Lichenicolous Fungus Record from The Çamlik National Park (Yozgat, Turkey), Tremella candelariellae (Basidiomycota, Tremellales)

N/A
N/A
Protected

Academic year: 2021

Share "A New Lichenicolous Fungus Record from The Çamlik National Park (Yozgat, Turkey), Tremella candelariellae (Basidiomycota, Tremellales)"

Copied!
4
0
0

Yükleniyor.... (view fulltext now)

Tam metin

(1)

KSÜ Tarım ve Doğa Derg 23 (2): 387-390, 2020 KSU J. Agric Nat 23 (2): 387-390, 2020 DOI:10.18016/ksutarimdoga.vi.565751

A New Lichenicolous Fungus Record from The Çamlik National Park (Yozgat, Turkey),

Tremella candelariellae (Basidiomycota, Tremellales)

Zekiye KOCAKAYA1, Mustafa KOCAKAYA2, Mehmet Ünsal BARAK3

University of Yozgat Bozok, Boğazlıyan Vocational School, Department of Organic Agriculture, 66400, Yozgat, Turkey 1https://orcid.org/0000-0001-5248-0462, 2https://orcid.org/0000-0003-2306-8094, 3https://orcid.org/0000-0002-2050-149x : [email protected]

ABSTRACT

Tremella candelariellae Diederich & Etayo was reported on

Candelariella antennaria Räsänen first time in Turkey.

Morphological, anatomical and ecological characteristics of the species are presented. In addition, the sequence analysis of the ITS region was performed and the phylogenetic tree was formed by closely related species. Research Article Article History Received : 15.05.2019 Accepted : 08.11.2019 Keywords Lichenicolous Fungus Molecular Phylogeny Taxonomy Tremella

Çamlık Milli Parkı (Yozgat, Türkiye)’ndan Yeni Bir Likenikol Mantar Kaydı, Tremella candelariellae

(Basidiomycota, Tremellales)

ÖZET

Tremella candelariellae Diederich & Etayo Türkiye'den ilk kez

Candelariella antennaria Räsänen üzerinden rapor edilmiştir. Türün morfolojik, anatomik ve ekolojik özellikleri verilmiştir. Ayrıca ITS bölgesine ait dizi analizi yapılarak yakın ilişkili türlerle birlikte filogenetik ağaç oluşturulmuştur.

Araştırma Makalesi Makale Tarihçesi Geliş Tarihi : 15.05.2019 Kabul Tarihi : 08.11.2019 Anahtar Kelimeler Likenikol Mantar Moleküler Filogeni Taksonomi Tremella

To Cite : Kocakaya Z, Kocakaya M, Barak MÜ 2020. A New Lichenicolous Fungus Record from The Çamlik National Park

(Yozgat, Turkey), Tremella candelariellae (Basidiomycota, Tremellales). KSU J. Agric Nat 23 (2): 387-390. DOI: 10.18016/ksutarimdoga.vi.565751.

INTRODUCTION

The genus Tremella Pers., contains predominantly mycoparasite species growing in a wide variety of basidiomycetes and ascomycetes fungi (Chen 1998).

Tremella species is highly variable in appearances, such as size, shape and colour. Lichenicolous species usually grow in the host's induced galls. However, they all have common features. All species within the genus have been found to be parasites and grow with them in the hymenium of other fungi (Pippola and Kotiranta, 2008). Millanes et al., 2012 studied the phylogenetic position of the genus and stated that fifty-one Tremella

species have been identified. Two lichenicolous

Tremella species were reported from Turkey (Halici, 2015; Kocakaya et al., 2018). In this study, morphological, anatomical, ecological and phylogenetic features of the species were given.

MATERIAL and METHOD

Lichen sample was collected from Çamlık National Park in 2017. Morphological and anatomical

investigations were performed under a

stereomicroscope (Olympus SZX10) and light microscope (Olympus BX53). They were examined by standard microscopic techniques. Measurements were made in water. The new record specimen is deposited in Yozgat Bozok University Herbarium Yozgat, Turkey.

DNA was extracted using the DNeasy Plant Mini Kit (Qiagen) following the manufacturer’s protocols with

minor modifications. ITS4

(TCCTCCGCTTATTGATATGC) (White et al., 1990)

and ITS1-F (CTTGGTCATTTAGAGGAAGTAA)

(Gardes and Bruns, 1993) were used to amplify the ITS sequence. PCR-amplification was carried out, following Millanes et al. (2012). PCR products were

(2)

KSÜ Tarım ve Doğa Derg 23 (2): 387-390, 2020

KSU J. Agric Nat 23 (2): 387-390, 2020 Araştırma Makalesi Research Article

388 visualized on a 1% agarose gel. The sequence of PCR product obtained from the Tremella sample was performed using the Big Dye Terminator Cycle Sequencing v3.1 (Macrogen, Holland) following the manufacturer’s protocol and analysed on an ABI 3730XL Genetic Analyser.

Sequence results were analyzed automatically using the Clustal W option in the BioEdit program, along with samples from Genbank. Details and GenBank accession numbers of the samples are listed in Table 1. Phylogenetic tree was constructed by Maximum Likelihood analysis using MEGA 7 program. Pairwise deletion was performed to delete and control data gaps. The tree reliability was tested with 1000 bootstrap replications. We selected the out groups used in the previous phylogenetic analysis of the genus Tremella

(Millanes, et al., 2012).

RESULTS and DISCUSSION Morphology and Anatomy

Tremella candelariellae Diederich & Etayo 1996 A detailed description is provided by Diederich, P. 1996 Some lichenicolous fungus is easily observed because they deform the host thallus and form large abnormally shaped galls. T. candelariella is an inconspicuous species that due to the small size of the host (Candelariella species). It is easily ignored in the herbarium, because it slightly deforms only small apothecia in the host (Lendemer, 2008). This species has been described on the thallus of Candelariella vitellina (Hoffm.) Müll. Arg. and C. xanthostigma

(Pers. ex Ach.) Lettau (Diederich, 1996). In our phylogenetic studies, appeared on the apothecia of C. antennaria (Figure 1. A). Galls occurs on the host thallus. Galls and host thallus are the same colour. Gall surfaces are pruinose and covered with numerous yellow crystals in microscopic sections.

Basidiomata superficial, convex, bright yellow galls on the host thallus, often with a granular, pruinose surface (Figure 1.A), 0.1-0.8 mm in diam., hyphae mixed with host hyphae, basidia, hyaline, ellipsoid, 2 celled 18-20 x 10-12 μm (Figure 1.B), basidiospores ellipsoid, hyaline 6.5-7 x 5-6 μm. Conidia not seen. Each particular species of Tremella is host-specific, often limited to a single fungal genus or species. Therefore, it was not seen on a different genus from

Candelariella. The most closely related species in phylogenetic studies is Tremella dendrographae

Diederich & Tehler. However, there are significant differences in morphological and anatomical studies.

T. dendrographae has larger basidia and longer basidiospores. In addition, host lichens are different. T. dendrographae prefer to Dendrographa Darb. genus as a host. While T. candelariella formed yellow galls, T. dendrographae formed whitish galls on the host thallus Besides, T. dendrographae is a very common fungus that causes a large and visible formation(Nash et al., 2004).

Specimen examined: Turkey, Yozgat, Çamlik National Park, on Pinus nigra bark, 39˚48̍ 047̎ N, 34˚ 48̍ 498̎ E, alt. 1613 m, August 26, 2017 (Herb. No: CMP 0.086).

Figure 1. A) Galls on apothecia of C. antennaria B) Basidia

Şekil 1. A) C. antennaria'nın apotesyumu üzerindeki gal oluşumu B) Bazidyum Distribution

The species was described in Luxembourg at a altitude of 300 m on C. vitellina (Diederich, 1996). Later in Italy, at a altitude of 1300 m, on C. xanthostigma

(Diederich, 1996) and in the U.S.A. In Pennsylvania on

C. xanthostigma (Lendemer, 2008). It also known from Poland (Kukwa and Jabłońska, 2008) and Sweden (Westberg, et al., 2008). Turkish specimen was collected in central Anatolia at Çamlik National Park,

1613 m at the altitude on C. antennaria.

Molecular Results

ITS sequence was successfully obtained. It was evaluated together with the sequence results from the gene bank (Table 1). The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura 3-parameter model (Tamura, 1992) (Figure 2).

(3)

KSÜ Tarım ve Doğa Derg 23 (2): 387-390, 2020

KSU J. Agric Nat 23 (2): 387-390, 2020 Araştırma Makalesi Research Article

389

Table 1. Sequences downloaded from GenBank and newly produced (bold).

Tablo 1. GenBank'tan indirilen ve yeni üretilen diziler (koyu renk).

Species Locality nrITS

Tremella caloplacae Greenland JN053468

T. caloplacae France JN053469 T. candelariellae Luxembourg JN053470 T. candelariellae Turkey MN566922 T. cetrariicola Finland JN053490 T. cetrariicola Latvia JN053491 T. cladoniae Estonia JN053477 T. cladoniae France JN053478 T. coppinsii UK JN053495 T. coppinsii Estonia JN053496 T. dendrographae USA JN053471 T. hypogymniae Sweden JN053484 T. hypogymniae Estonia JN053485 T. lobariacearum Madeira JN053473

T. lobariacearum Canary Islands JN053474

T. phaeophysciae Luxembourg JN053479

T. phaeophysciae Estonia JN053480

T. umbilicariae Peru KM507564

Phaeotremella pseudofoliacea Sweden JN053502

Filobasidium uniguttulatum - AF444302

F. floriforme - AF190007

Figure 2. Maximum likelihood analysis of the ITS region of T. candelariellae and related species. Numbers at tree nodes indicate bootstrap values of ML (only values ≥50%).

Şekil 2. T. candelariellae ve ilişkili türlerin ITS bölgesine ait maksimum olabilirlik analizi. Ağaç nodlarındaki sayılar, ML'nin bootstrap değerlerini gösterir (sadece ≥% 50 değerleri).

(4)

KSÜ Tarım ve Doğa Derg 23 (2): 387-390, 2020

KSU J. Agric Nat 23 (2): 387-390, 2020 Araştırma Makalesi Research Article

390 The sequence result compared with the Luxembourg sample in the gene bank. Our sequence result is matched in the phylogenetic tree with this sample. T. candelariella is similar to T. dendrographa as the morphological and anatomical features. Also, this species are located in the same clad in phylogenetic tree.

ACKNOWLEDGMENTS

This study was financially supported by Yozgat Bozok University project with the project number of 6602b-FEF/16-45.

Statement of Conflict of Interest

Authors have declared no conflict of interest.

Author’s Contributions

The contribution of the authors is equal.

REFERENCES

Chen CJ 1998. Morphological and molecular studies in the genus Tremella. Bibliotheca Mycologica, 174: 1– 225.

Diederich P 1996. The Lichenicolous

Heterobasidiomycetes. Bibliotheca Lichenologica, 61:1-198.

Gardes M, Bruns TD 1993. ITS Primers with Enhanced Specificity For basidiomycetes - Application to the Identification of Mycorrhizae and Rusts. Molecular Ecology, 2: 113–118.

Halici MG 2015. New records of Crustose Teloschistaceae and Lichenicolous Fungi from Turkey. Mycotaxon, 130: 769-773.

Kocakaya M, Kocakaya Z, Barak MÜ 2018. A New

Lichenicolous Fungus Record from the Turkey,

Tremella macrobasidiata (Basidiomycota, Tremellales). Süleyman Demirel Üniversitesi Fen Bilimleri Enstitüsü Dergisi, 22(1): 95-97.

Kukwa M, Jabłońska A 2008. New or interesting records of lichenicolous fungi from Poland VI. – Herzogia, 21: 167–179.

Lendemer JC 2008. New and Interesting Records of Lichens and Lichenicolous Fungi from New Jersey and Pennsylvania. Evansia, 25(4): 102-109.

Millanes AM, Westberg M, Wedin M, Diederich P 2012.

Tremella diploschistina (Tremellomycetes, Basidiomycota, Fungi), A New Lichenicolous Species Growing on Diploschistes. Lichenologist, 44(3): 321-332.

Nash TH, Ryan BD, Gries C, Bungartz F 2004. Lichen Flora of the Greater Sonoran Desert Region. Vol II. Arizona, Lichens Unlimited.

Tamura K 1992. Estimation of the Number of Nucleotide Substitutions When There are Strong Transition-transversion and G+C-Content Biases. Molecular Biology and Evolution, 9: 678-687. Pippola E, Kotiranta H 2008. The genus Tremella

(Basidiomycota, Tremellales) in Finland. Ann. Bot. Fennici, 45: 401–434.

Westberg M, Millanes AM, Wedin M 2008. Tremella candelariellae – en ny lavparasiterande basidiesvamp för Sverige. Lavbulletinen, 2: 74–77.

White TJ, Bruns T, Lee S, Taylor J 1990. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In: PCR Protocols: a Guide to Methods and Applications. (Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds). Academic Press, New York, USA: 315–322.

Referanslar

Benzer Belgeler

Prognostic value of evoked potential obtained by transcranial magnetic brain stimulation in motor function recovery in patients with acute ischemic stroke.. Prognostic

• The Rashidun army was the primary military body of the Muslims during the Muslim conquests of the 7th century, serving alongside the Rashidun navy.. • The three most

Bununla birlikte, Kur’an ve Sünnet ile kanunilik ilkesi arasında günümüz ceza hukuk doktri- ninde kabul gören şekliyle, tam anlamıyla örtüşen bir yapıdan söz

The first chapter analyzes developments on the political scene; the second focuses more on political happenings within the civil society, with emphasis on the issue

anethoides by having sparsely to densely scabrid hairy stem and leaf (not glabrous), sometimes having ternate leaves and ovate mericarp shape (not elliptic to oblong)..

20 Zorunlu bütün unsurları, inikâd/kuruluş (ehliyet, meclis birliği, ittifak edilen evlenme manilerinin bulunmaması, icap ve kabulün şartsız olması) ve

“Sınıf Öğretmeni Adaylarının Kişisel Ve Aile Özellikleri İle Öğrenim Gördükleri Program, Öğretmenlik Mesleği Ve Yaşama İlişkin Görüşleri / Personal

Tanrı’nın varlığının delillerinden biri sayılan klasik ontolojik delil, kendisinden daha mükemmeli tasavvur edilemeyen bir varlık kavramının zihinde