• Sonuç bulunamadı

High-fructose corn syrup-induced hepatic dysfunction in rats: improving effect of resveratrol

N/A
N/A
Protected

Academic year: 2021

Share "High-fructose corn syrup-induced hepatic dysfunction in rats: improving effect of resveratrol"

Copied!
10
0
0

Yükleniyor.... (view fulltext now)

Tam metin

(1)

O R I G I N A L C O N T R I B U T I O N

High-fructose corn syrup-induced hepatic dysfunction in rats:

improving effect of resveratrol

Gokhan Sadi•Volkan ErginGuldal Yilmaz• M. Bilgehan Pektas• O. Gokhan Yildirim• Adnan Menevse• Fatma Akar

Received: 3 February 2014 / Accepted: 27 August 2014 / Published online: 11 September 2014 Ó Springer-Verlag Berlin Heidelberg 2014

Abstract

Purpose The increased consumption of high-fructose corn syrup (HFCS) may contribute to the worldwide epi-demic of fatty liver. In this study, we have investigated whether HFCS intake (20 % beverages) influences lipid synthesis and accumulation in conjunction with insulin receptor substrate-1/2 (IRS-1; IRS-2), endothelial nitric oxide synthase (eNOS), sirtuin 1 (SIRT1) and inducible NOS (iNOS) expressions in liver of rats. Resveratrol was tested for its potential efficacy on changes induced by HFCS.

Methods Animals were randomly divided into four groups as control, resveratrol, HFCS and resveratrol plus HFCS (resveratrol ? HFCS). HFCS was given as 20 % solutions in drinking water. Feeding of all rats was main-tained by a standard diet that enriched with or without resveratrol for 12 weeks.

Results Dietary HFCS increased triglyceride content and caused mild microvesicular steatosis in association with up-regulation of fatty acid synthase and sterol regulatory

element binding protein (SREBP)-1c in liver of rats. Moreover, HFCS feeding impaired hepatic expression levels of IRS-1, eNOS and SIRT1 mRNA/proteins, but did not change iNOS level. Resveratrol promoted IRS, eNOS and SIRT1, whereas suppressed SREBP-1c expression in rats fed with HFCS.

Conclusions Resveratrol supplementation considerably restored hepatic changes induced by HFCS. The improve-ment of hepatic insulin signaling and activation of SIRT1 by resveratrol may be associated with decreased triglyc-eride content and expression levels of the lipogenic genes of the liver.

Keywords High-fructose corn syrup Resveratrol  Hepatic lipid FASN  SREBP-1c  IRS-1  eNOS  SIRT1 Abbreviations

HFCS High-fructose corn syrup NAFLD Non-alcoholic fatty liver disease

Res Resveratrol

IRS-1; IRS-2 Insulin receptor substrate-1/2 eNOS Endothelial nitric oxide synthase SIRT1 Sirtuin 1

iNOS Inducible nitric oxide synthase FASN Fatty acid synthase

SREBP Sterol regulatory element binding protein GAPDH Glyceraldehyde 3-phosphate

dehydrogenase

PI3K Phosphatidylinositol 3-kinase AST Aspartate aminotransferase ALT Alanine aminotransferase H&E Hematoxylin and eosin

ORO Oil Red O

TBST Tris buffer with NaCl–Tween HRP Horseradish peroxidase G. Sadi

Department of Biology, Faculty of Science, Karamanoglu Mehmetbey University, Karaman, Turkey

V. Ergin A. Menevse

Department of Medical Biology and Genetics, Faculty of Medicine, Gazi University, Ankara, Turkey

G. Yilmaz

Department of Medical Pathology, Faculty of Medicine, Gazi University, Ankara, Turkey

M. B. Pektas O. G. Yildirim  F. Akar (&) Department of Pharmacology, Faculty of Pharmacy, Gazi University, Ankara, Turkey

e-mail: [email protected] DOI 10.1007/s00394-014-0765-1

(2)

Introduction

Excess dietary fructose may cause adverse alterations of metabolic, hepatic and vascular functions [1]. High-fruc-tose corn syrup (HFCS), one of the major sources of fructose, is still used as a sweetener in processed foods and soft drinks despite ongoing negative debate [2]. In fact, the data on the consequences of HFCS intake is very limited. In rodents, dietary HFCS was shown to cause hyperinsu-linemia, hypertriglyceridemia and hepatic steatosis [3–6]. Recently, we showed that HFCS-induced metabolic dis-turbance was associated with endothelial dysfunction, insulin resistance, down-regulation of insulin receptor substrate-1 (IRS-1), endothelial nitric oxide synthase (eNOS) and sirtuin 1 (SIRT1) as well as up-regulation of inducible NOS (iNOS) and NADPH oxidase in aorta of rats [5,6].

Non-alcoholic fatty liver disease (NAFLD) is one of the hepatic manifestations of metabolic syndrome and the most common diseases in Western populations. Hepatic lipid accumulation is likely involved in excessive lipogenesis and insulin resistance, thereby leading to NAFLD, and progressing with inflammation [7, 8]. Administration of high fructose to rats was shown to cause hyperinsulinemia accompanied by hepatic triglyceride accumulation along with microvesicular and macrovesicular fat deposition [9,

10]. Fructose-induced fatty liver has been linked to up-regulation of lipogenic genes such as sterol regulatory element binding protein (SREBP)-1 and fatty acid synthase (FASN) together with induction of inflammatory mediators in mice [8, 11]. Recently, fructose-feeding-induced SREBP-1 gene expression was shown to be driven by either or both insulin-dependent or insulin-independent pathways [12]. Animal data showed that dietary HFCS causes hepatic triglyceride accumulation [3, 13] but its involvement in insulin signaling, SIRT1 and lipogenic genes requires further study.

IRS-1 and IRS-2 transmit insulin receptor signaling to intracellular effectors and regulate carbohydrate and lipid metabolism activating phosphatidylinositol 3-kinase (PI3K) pathway in the liver [14,15]. Fructose feeding was shown to inhibit hepatic insulin signaling through decreased IRS-1/2, PI3K and eNOS protein expressions in liver of rats [16–18]. Resveratrol has capacity to restore hepatic IRS-1-mediated PI3-kinase signaling as well as to improve insulin sensitivity in IRS-2-deficient mice by reducing tyrosine phosphatase 1B mRNA expression [19]. Previously, resveratrol was shown to contribute to the improvement of insulin resistance and hepatic steatosis in mice on a high-fat diet, possibly by acting on a SIRT1-dependent mechanism [20,21]. We have recently demon-strated that resveratrol improves vascular insulin

resistance, endothelial dysfunction and accompanying hypertriglyceridemia and hyperinsulinemia by promoting eNOS and SIRT1 expressions in rats fed with HFCS [5,6]. Extending our previous works, we performed this study to examine whether dietary HFCS enriched with or without resveratrol changes hepatic function in conjunction with IRS/eNOS, SIRT1 and iNOS expressions. Thus, we investigated (1) liver pathology and triglyceride content, (2) hepatic expression of key lipogenic genes and (3) hepatic expression of IR, IRS-1/2, eNOS, SIRT1 and iNOS in rats fed with HFCS and/or resveratrol.

Materials and methods Animals and diets

The animal protocols were approved by the Ethical Animal Research Committee of Gazi University (G.U. ET-11.068). Male Wistar rats aged 10 weeks were housed in the tem-perature- and humidity-controlled rooms with a 12-h light– dark cycle. The rats were fed a standard diet that contains approximately 62 % starch, 23 % protein, 4 % fat, 7 % cellulose, standard vitamins and salt mixture. At the end of acclimation for 1 week, the animals were randomly divided into four groups applying different protocols: control, res-veratrol, HFCS and resveratrol plus HFCS (resvera-trol ? HFCS). Trans-resvera(resvera-trol (Herb-Tech) was mixed with standard chow at dose of 500 mg/kg, which is kept under protection from light. Feeding for all rats was maintained by a standard diet enriched with or without resveratrol for 12 weeks. HFCS (Cargill F55; 56 % fruc-tose and 37 % glucose) was diluted as 20 % (w/v) solutions in drinking water and provided to rats ad libitum for 12 weeks. Methods and data representing daily food, liquid and caloric intakes, body weights as well as resveratrol and HFCS ingestions of rats have recently been published [6]; therefore, they were not further detailed in the current study. At the end of follow-up period, the rats were anes-thetized with a mixture of ketamine–xylazine (100 and 10 mg/kg, respectively, i.p.), and blood samples were rapidly collected. Whole livers were dissected, washed, blotted dry and weighted. Liver samples were frozen in liquid nitrogen and stored at -85°C until assayed. Liver enzymes in the plasma

Cardiac blood samples of non-fasted rats were immediately centrifuged at 4°C and 10,000g for 30 min. Plasma aspartate aminotransferase (AST) and alanine aminotrans-ferase (ALT) levels were determined by standard enzy-matic techniques.

(3)

Hepatic triglyceride assay

The liver samples were homogenized in methanol/chloro-form (1:2) according to the method as previously described [22]. After evaporation, the extracts were dissolved in absolute ethanol. Hepatic triglyceride content was mea-sured using a commercially available colorimetric assay kit (Cayman). Results were given as mg triglyceride per gram liver.

Liver histology

Samples excised from the liver were fixed with 10 % for-malin and embedded in paraffin. Serial sections (thickness of 4 lm) were processed and stained with hematoxylin and eosin (H&E), according to standard pathology laboratory procedures. Stained liver slices were evaluated under light microscopy (Olympus BX50, Olympus, Tokyo, Japan) by a liver pathologist. Cryostat sections of liver (thickness of 4 lm) were stained with Oil Red O (ORO; Sigma-Aldrich), washed and counterstained with hematoxylin. Images were captured using a photography device (Olympus DP12-2, Tokyo, Japan).

Quantitative real-time PCR

Total RNAs were isolated by using RNeasy total RNA isolation kit (Qiagen, Venlo, Netherland), amount and the quality of total RNA were determined by spectrophotom-etry and agarose gel electrophoresis. Total RNA (1 lg) was reverse transcribed to cDNA using first-strand cDNA Synthesis Kit (Roche Diagnostics GmbH, Mannheim, Germany), and transcription levels of interested genes were determined by real-time PCR using a Light Cycler 480 II System (Roche Diagnostics GmbH, Mannheim, Germany). Real-time quantitative PCR was conducted using Light CyclerÒ 480 Probes Master or LightCyclerÒ 480 SYBR Green I Master using Roche prevalidated TaqMan primer/ probe sets or SYBR Green technology.

The commercially available and prevalidated Roche TaqMan primer/probes sets used were as follows: b-Actin: CCCGCGAGTACAACCTTCT and CGTCATCCATGGC GAACT with probe #17; FASN: GCTGAAGACTTCC CCAACG and TGGCGTCAATGTTGTAGACTG with probe #17; DGAT2: GGGTCCTATCCTTCCTGGTG and GGGCGTGTTCCAGTCAAA with probe #20; CPT1a: CTCCTTTCCTGGACGAGGT and GATCTGGAACTGG GGGATCT with probe #22; SREBP-1c: ACAAGATTGT GGAGCTCAAGG and TGCGCAAGACAGCAGATTTA with probe #77.

The prevalidated SYBR Green primers were purchased from Iontek (Bursa, Turkey), and the primers sequences

used were as follows: b-actin: CTGACCGAGCGTGGC TAC and CCTGCTTGCTGATCCACA; IR: GTGCTGCT CATGTCCTTAGA and AATGGTCTGTGCTCTTCGTG; IRS-1: GCCAATCTTCATCCAGTTGC and CATCGTGA AGAAGGCATAGG; IRS-2: CTACCCACTGAGCCCAA

GAG and CCAGGGATGAAGCAGGACTA; eNOS:

TGCACCCTTCCGGGGATTCT and GGATCCCTGGAA AAGGCGGT; SIRT1: CGGTCTGTCAGCATCATCTTCC and CGCCTTATCCTCTAGTTCCTGTG; iNOS: CTTCAG GTATGCGGTATTGG and CATGGTGAACACGTTCTT GG. All primer sequences were given in 50–30 direction.

Real-time PCR was performed according to following conditions: activation and DNA denaturation at 95 °C for 10 min, followed by 50 amplification cycles for 10 s at 95°C and 20 s at 60 °C and finally a cooling step to 40 °C. For each sample, the levels of target gene transcripts were normalized to the internal standard. PCRs were carried out in triplicates, and negative controls lacking template were used in all reactions. Relative expressions of genes with respect to internal control were calculated with the effi-ciency-corrected advance relative quantification tool of the LightCyclerÒ480 SW 1.5.1 software.

Western blot analysis

Frozen liver samples were homogenized in two volumes of homogenization medium containing 50 mM Tris, 150 mM NaCl, 5 mM EDTA, 1 % (w/w) Triton x-100, 0.26 % (w/ v) sodium deoxycholate, 50 mM sodium floride, 0.1 mM sodium orthovanadate and 0.2 mM PMSF by using Tissue RuptorTM(Qiagen, Venlo, Netherlands) homogenizer and centrifuged at 1,500g for 10 min at 4°C. The supernatants were used for the determination of expression of IRS-1, eNOS, SIRT1 and iNOS proteins with Western blot. The protein concentration of each sample was determined using the Lowry method [23].

Equal protein samples (50 lg) from each rat liver were subjected to polyacrylamide gel electrophoresis with anionic detergent SDS on 4 % stacking gel and 10 % separating gel by Mini Protean Tetra electrophoresis apparatus (Bio-Rad Laboratories) and electroblotted onto PVDF membrane [24]. The blotted membranes were washed with Tris buffer with NaCl–Tween (TBST). After blocking with 5 % BSA, interested proteins were subjected to primary antibodies: IRS-1 (anti-IRS-1 rabbit IgG, Ab-cam, 1/1,000), eNOS (anti-eNOS rabbit IgG, AbAb-cam, 1/1,000), SIRT1 (anti-SIRT1 rabbit IgG, Santa Cruz, 1/1,000), iNOS (anti-iNOS rabbit IgG, Abcam, 1/1,000) or GAPDH (anti-GAPDH rabbit IgG, Santa Cruz, 1/2,000) for 2 h with constant shaking or overnight at ?4°C. Horse-radish peroxidase (HRP)-conjugated secondary antibody (goat anti-rabbit IgG-HRP conjugate, Santa Cruz, 1/10,000) was applied for 1 h, and then, the blots were incubated in

(4)

ClarityTM Western ECL (Bio-Rad Laboratories, Hercules CA, USA) substrate solution for five min. Images of the blots were taken with ChemiDocTM MP chemilumines-cence detection system (Bio-Rad Laboratories, Hercules CA, USA) with CCD camera. Relative expressions of proteins with respect to reference protein were calculated with ImageLab4.1 software.

Statistical analysis

All data are given as mean ± standard error of the mean; n is the number of rats. Statistical comparisons were per-formed by using unpaired Student’s t test or one-way ANOVA followed by the Bonferroni post hoc test. The results of TaqMan-based real-time PCR assay were eval-uated by using the pairwise fixed reallocation randomiza-tion test. p values smaller than 0.05 were considered as statistically significant.

Results

Resveratrol intake and body weight of rats

The resveratrol intake calculated from chow consumption was found to be approximately 46 mg/kg body weight/ day in resveratrol group and 28 mg/kg body weight/day in resveratrol plus HFCS group. The daily average caloric intake of the rats was quantified from consump-tions of chow and HFCS sweetened water. As described in our recent study [6], caloric intake and body weight in HFCS group were significantly lower than those of control rats and unchanged after resveratrol supplemen-tation (Table1).

Dietary HFCS increases hepatic triglyceride content and causes fatty liver: restorative effect of resveratrol HFCS diet feeding increased the liver triglyceride content and ratio of liver weight to final body weight when compared to control group. Resveratrol supplementation partially restored these abnormalities in rats fed with HFCS (Table1). Plasma levels of liver enzymes ALT and AST, which are the indica-tors of hepatic injury, did not differ between the groups.

As shown in Fig. 1, liver histological examination revealed that dietary HFCS produced microvesicular stea-tosis around the central veins (zone 3 area as noted by H&E and ORO staining). Resveratrol supplementation slightly prevented the development of fatty liver. There was no evidence for fat deposition in the sections of livers obtained from control and resveratrol groups.

Dietary HFCS up-regulates FASN and SREBP-1c in liver of rats: restorative effect of resveratrol

FASN, which is a key enzyme for the synthesis of long-chain fatty acids, was dramatically increased in liver of rats given HFCS. Resveratrol supplementation to rats fed with HFCS significantly suppressed the mRNA expression level of the gene (Fig.2a). Another gene, DGAT2, which catalyzes the final reaction in the synthesis of triglyceride, was not chan-ged in liver of rats fed with HFCS or resveratrol (Fig. 2b). Expression of CPT1a, which catalyzes an important regu-latory step in lipid metabolism, was also not apparently affected by dietary HFCS or resveratrol (Fig.2c). SREBP-1c is a transcription factor that regulates expression of numer-ous genes involved in fat metabolism. There was a marked functional up-regulation of SREBP-1c in liver of rats fed with HFCS. Resveratrol supplementation significantly sup-pressed the expression of SREBP-1c (Fig.2d).

Table 1 Body and liver weights, food, liquid and caloric intake amounts, liver triglyceride contents, plasma AST and ALT levels in rats from control, resveratrol, HFCS or resveratrol plus HFCS groups

Groups Control Resveratrol HFCS Resveratrol ? HFCS

Initial body weight (g) 215 ± 2.1 211 ± 2.2 208 ± 2.5 207 ± 2.6 Terminal body weight (g) 328 ± 4.2 291 ± 3.8* 295 ± 3* 296 ± 3.6*

Food intake (g/day) 24.5 ± 0.6 27.3 ± 0.4 16 ± 0.6* 17 ± 0.6*

Liquid intake (ml/100 g bw) 15.7 ± 1 27.3 ± 0.8* 15.8 ± 1.6 15.7 ± 1.1 Total caloric intake (kcal) 85.9 ± 1.9 95.5 ± 1.5 65.7 ± 3* 65.3 ± 1.8* Liver weight (g) 13.2 ± 0.7 11.8 ± 0.3# 14.7 ± 0.5 13.4 ± 0.4 Liver weight/body weight (%) 4.1 ± 0.2 4.1 ± 0.1 4.9 ± 0.1* 4.5 ± 0.1 Liver triglyceride content (mg/g) 18.7 ± 0.8 19.3 ± 0.6 38.2 ± 1.5* 27.2 ± 2.4#

AST (IU/l) 73.1 ± 2.6 83 ± 6.8 88.9 ± 2.8 81.7 ± 2.6

ALT (IU/l) 48.3 ± 1.4 47.2 ± 1.7 43 ± 1.5 43.3 ± 2.2

Values are expressed as mean ± SEM, n = 6–10

(5)

Fig. 1 Histopathological features of the liver sections from control, resveratrol (Res), HFCS or resveratrol plus HFCS groups. H&E and ORO staining (9100) show microvesicular fat deposition in HFCS

group. Resveratrol supplementation slightly prevented microvesicular steatosis in rats fed with HFCS. Sections of livers from control and resveratrol groups appear normal

Fig. 2 FASN (a), DGAT2 (b), CPT1a (c) and SREBP-1c (d) mRNA levels in the livers from control, resveratrol (Res), HFCS or resveratrol plus HFCS groups. mRNA expression was normalized

with corresponding b-actin. Each bar represents at least four rats. *p \ 0.05, significantly different from control; #p\ 0.05, signifi-cantly different from HFCS

(6)

Dietary HFCS decreases IRS-1, eNOS and SIRT1 mRNA and protein levels in liver of rats: restorative effect of resveratrol

To investigate a potential relationship between triglyceride accumulation and insulin signaling in liver, we studied the expression levels of IRS-1, eNOS, SIRT1 as well as iNOS by using the real-time PCR and Western blot. As shown in Figs.3a and 4a, b, dietary HFCS reduced IRS-1 mRNA and protein levels in the liver. Resveratrol supplementation of rats fed with HFCS produced elevations in the expres-sion levels of 1. In accordance with the results of IRS-1, dietary HFCS decreased eNOS mRNA and protein expression levels in the liver which were almost normal-ized by resveratrol supplementation (Figs.3b, 4a, c). Moreover, SIRT1 mRNA and protein expression levels were decreased in liver of rats fed with HFCS, when compared to controls. Resveratrol supplementation up-regulated the expression levels of SIRT1 (Figs.3c, 4a, d). Expression levels of iNOS mRNA and protein were not changed in the liver from rats fed with HFCS. Surprisingly, resveratrol supplementation suppressed iNOS protein expression significantly, but not mRNA level, in livers of rats fed with either HFCS or the standard chow

(Figs. 3d, 4a, e). Dietary HFCS did not alter expression levels of insulin receptor (IR) and IRS-2 mRNA in the liver samples. However, resveratrol substantially increased the level of IRS-2 mRNA (Fig.5a, b). These results suggested that HFCS diet feeding leads to hepatic down-regulations of IRS-1, eNOS and SIRT1, which are restored by resve-ratrol supplementation.

Discussion

Our recent studies showed that dietary HFCS causes hyperinsulinemia, hypertriglyceridemia, vascular insulin resistance and endothelial dysfunction, which are markedly improved by resveratrol supplementation in the rats [5,6]. Herein, we investigated the influences of dietary HFCS and resveratrol on hepatic function. Inclusion of HFCS in the diet of rats causes various hepatic abnormalities including mild microvesicular fat deposition, triglyceride accumula-tion and augmented liver weight together with the increased expression levels of FASN and SREBP-1c. These changes were associated with down-regulation of IRS-1, eNOS and SIRT1. Resveratrol supplementation exerted parallel improvements in all of these parameters.

Fig. 3 IRS-1 (a), eNOS (b), SIRT1 (c) and iNOS (d) mRNA levels in the livers from control, resveratrol (Res), HFCS or resveratrol plus HFCS groups. mRNA expression was normalized with corresponding

b-actin. Each bar represents at least four rats. *p \ 0.05, significantly different from control;#p\ 0.05, significantly different from HFCS

(7)

Dietary fructose causes hyperinsulinemia which leads to the stimulation of lipogenesis in the liver along with insufficient control of hyperglycemia [25], as proposed in obesity and type-2 diabetes [26]. Hence, hyperinsulinemia plausibly occurs as a compensatory mechanism to suppress hyperglycemia. Fructose feeding was recently demon-strated to cause induction of SREBP-1c and lipogenic gene expression driven by either or both insulin-dependent or insulin-independent pathways. The last has been suggested for direct activation of SREBP-1c by nutrients and other hormones in the absence of insulin [12]. However, in liver insulin receptor knockout mice, high-fructose diet-induced FASN and SREBP-1c expressions did not lead to hepatic

steatosis indicating a dominant role of hepatic insulin sig-naling for triglycerides metabolism [12]. Fructose-induced hepatic triglyceride accumulation was found to be associ-ated with the increased expression of FASN and SREBP-1 as well as the induction of tumor necrosis factor-a (TNF-a) and iNOS in liver of mice, which suggested the co-acti-vation of lipogenesis and inflammation [11, 27]. Previ-ously, dietary HFCS intake in mice has been proposed to cause microvesicular steatosis and hepatic triglyceride accumulation by increasing the expression of the genes involved in carbohydrate and lipid metabolism such as, aldehyde dehydrogenase, acetyl-CoA carboxylase alpha and oxidoreductase [3,13]. Here, in the rats given HFCS, Fig. 4 Representative gels for IRS-1, eNOS, SIRT1 and iNOS

protein expressions measured by Western blot (a). IRS-1 (b), eNOS (c), SIRT1 (d) and iNOS (e) protein levels in the livers from control, resveratrol (Res), HFCS or resveratrol plus HFCS groups. The

intensity of the bands was quantified by densitometric analysis and normalized with corresponding GAPDH. Each bar represents at least four rats. *p \ 0.05, significantly different from control;#p\ 0.05, significantly different from HFCS

(8)

mild microvesicular fat deposition was accompanied by increased liver weight, triglyceride content and expression levels of FASN and SREBP-1c mRNA. In relation to the inflammatory status, we were unable to detect any signif-icant increase either in the liver iNOS expression or in the plasma levels of liver enzymes (ALT and AST). However, there was a modest trend toward an increment in iNOS mRNA and protein expressions suggesting that hepatic injury may be evident in the long-term administration of HFCS. Indeed, NAFLD has been characterized by the initiation of intrahepatic fat accumulation and found to be aggravated by the induction of inflammatory mediators [8]. Previously, high-fat diet feeding was shown to cause an early onset of the inflammation process and insulin resis-tance in the vasculature than those of observed in the skeletal muscle and the liver, possibly indicating a higher susceptibility to the deleterious effects of nutritional overloading in the vascular system [28]. In concert with this depiction, herein, we determined subinflammatory state in the liver, whereas we had detected a significant increase in iNOS in the vascular tissue of rats fed with HFCS [6] confirming the early vascular injury.

Overexpression of SIRT1 in mice prevents high-fat diet-induced fatty liver in association with low levels of SREBP-1c, IL-6 and TNFa mRNA, thereby linking SIRT1 function with lipogenesis and inflammation [29]. More-over, hepatic overexpression of SIRT1 inhibited SREBP-1c activity improving hepatic lipogenesis in diet-induced obese mice [30]. These findings may implicate that SIRT1 regulates lipogenesis in the liver. In the current study, decreased level of SIRT1 mRNA and protein expressions in liver of rats fed with HFCS and the accompanying up-regulation of SREBP-1c likely support this proposal.

Control of glucose and lipid metabolism in liver is mediated by IRS-1 and IRS-2 transmitting insulin receptor signaling to intracellular effectors [14,15]. Besides to these insulin signaling related molecules, recent studies indicate

the existence of a functional interaction between insulin signaling and eNOS or SIRT1 [31, 32]. Activation of SIRT1 improves insulin sensitivity in hepatocyte-derived cell lines and in muscle biopsies obtained from type 2 diabetic patients [31,32]. Dietary fructose was shown to inhibit hepatic insulin signaling by decreasing expression levels of IRS-1/2, PI3K and eNOS proteins in liver of rats [16–18]. Recently, we have reported that dietary HFCS decreased nitric oxide-mediated relaxations in association with reduced expression of IRS-1, eNOS and SIRT1 and thereby may restrict insulin delivery to target tissues including the liver [5, 6]. Thus, the relative insulin defi-ciency caused by dietary HFCS could be expected to affect hepatic gene and protein expressions of a number of insulin-signaling molecules including IR, IRS-1/2, eNOS as well as SIRT1. Herein, HFCS impaired insulin signaling in the liver, as evidenced by down-regulation of IRS-1, eNOS and SIRT1 mRNA and protein, which could be a support for shifting of fructose metabolism to insulin-independent de novo lipogenesis. Combined with our very recent findings, which are obtained from same animals [6], hepatic and vascular dysfunctions co-occurred in rats fed with HFCS. Thus, it can be assumed that, there is a com-mon link between hepatic and vascular insulin resistances that is obvious at the level of IRS/eNOS signaling.

It was previously demonstrated that resveratrol increases the phosphorylation of insulin receptor in insulin-resistant soleus muscle of rats on a high cholesterol–fructose diet, thereby stimulating muscular glucose uptake [33]. Herein, resveratrol supplementation increased IRS-1 mRNA and protein as well as IRS-2 mRNA levels in livers of rats fed with HFCS, thereby indicating a diversity from our previ-ous vascular results which showed any change in these parameters [6]. These findings suggested that resveratrol could be effecting on hepatic insulin-signaling pathway differently from that of vasculature. Likewise, some dis-crepancies have been reported regarding action of Fig. 5 IR (a) and IRS-2 (b) mRNA levels in the livers from control, resveratrol (Res), HFCS or resveratrol plus HFCS groups. mRNA expression was normalized with corresponding b-actin. Each bar represents at least four rats

(9)

resveratrol on insulin signaling, which may change depending on metabolic status as well as cell and tissue type [32,34,35]. Intriguingly, eNOS is functionally acti-vated by trafficking of insulin signaling in vasculature [36]. Therefore, here, resveratrol-induced promoting effect on eNOS production may contribute to the improvement on insulin signaling.

Resveratrol supplementation also improved hepatic parameters including the increased liver weight and tri-glyceride accumulation as well as the expressions of FASN and SREBP-1c, which are associated with the fatty liver in rats fed with HFCS. These findings raise the possibility that correction of IRS/eNOS signaling pathway by resveratrol contributes to the improvement of hepatic lipogenesis by suppressing FASN and SREBP-1c. HFCS and resveratrol reciprocally affect liver IRS/eNOS signaling pathway, which may have a role on hepatic function. Considering resveratrol as a SIRT1 activator, an alleviation in insulin resistance and hepatic steatosis was shown in mice on a high-fat diet [20,21]. In HepG2 cells, resveratrol reduced fat accumulation and SREBP1 expression accompanied by up-regulation of SIRT1 expression [37]. Activation of SIRT1 by resveratrol was shown to control increased SREBP-1c activity in diet-induced obese mice [30]. Herein, resveratrol increased SIRT1 while decreasing SREBP-1c in rats fed with HFCS. Taken together, our results support the concept that the SIRT1 activation by resveratrol may protect from fatty liver by limiting lipo-genesis. Regarding of the existence of a reverse relation-ship between iNOS and insulin signaling in the liver [38], we did not find evidence for iNOS induction by HFCS feeding. However, we cannot rule out the possibility that the suppressive tendency produced by resveratrol on the expression of iNOS may provide a support to its control-ling effect on insulin resistance.

In the present study, the novel finding was that HFCS-induced liver triglyceride accumulation might be related to up-regulation of FASN and SREBP-1c together with attenuation of IRS/eNOS signaling and SIRT1 expression in the liver. Resveratrol exerted beneficial effects on HFCS-induced hepatic dysfunction by revitalizing the affected pathways. Combined with our recent studies on the HFCS [5,6], it can be proposed that inclusion of HFCS in diet causes hepatic, metabolic and vascular dysfunction. Resveratrol supplementation could be useful in the allevi-ation of HFCS-induced disturbances. The relevance of our results to human subject remains to be investigated, but our findings reflect deleterious effect of HFCS and promising benefit of resveratrol.

Acknowledgments This study was supported by grants from Gazi University Research Fund (BAP 02/2011-39 and 02/2012-48).

Conflict of interest There is no conflict of interest to disclose for any of the authors.

References

1. Stanhope KL, Havel PJ (2010) Fructose consumption: recent results and their potential implications. Ann N Y Acad Sci 1190:15–24. doi:10.1111/j.1749-6632.2009.05266.x

2. Heiss SN (2013) ‘‘Healthy’’ discussions about risk: The corn refiners association’s strategic negotiation of authority in the debate over high fructose corn syrup. Public Underst Sci 22:219–235. doi:10.1177/0963662511402281

3. Collison KS, Saleh SM, Bakheet RH et al (2009) Diabetes of the liver: the link between nonalcoholic fatty liver disease and HFCS-55. Obesity (Silver Spring) 17:2003–2013. doi:10.1038/ oby.2009.58

4. Bocarsly ME, Powell ES, Avena NM, Hoebel BG (2010) High-fructose corn syrup causes characteristics of obesity in rats: increased body weight, body fat and triglyceride levels. Phar-macol Biochem Behav 97:101–106. doi:10.1016/j.pbb.2010.02. 012

5. Akar F, Uludag˘ O, Aydın A et al (2012) High-fructose corn syrup causes vascular dysfunction associated with metabolic distur-bance in rats: protective effect of resveratrol. Food Chem Toxicol 50:2135–2141. doi:10.1016/j.fct.2012.03.061

6. Babacanoglu C, Yildirim N, Sadi G et al (2013) Resveratrol prevents high-fructose corn syrup-induced vascular insulin resistance and dysfunction in rats. Food Chem Toxicol 60:160–167. doi:10.1016/j.fct.2013.07.026

7. Postic C, Girard J (2008) Contribution of de novo fatty acid synthesis to hepatic steatosis and insulin resistance: lessons from genetically engineered mice. J Clin Invest 118:829–838. doi:10. 1172/JCI34275

8. Nomura K, Yamanouchi T (2012) The role of fructose-enriched diets in mechanisms of nonalcoholic fatty liver disease. J Nutr Biochem 23:203–208. doi:10.1016/j.jnutbio.2011.09.006

9. Ackerman Z, Oron-Herman M, Grozovski M et al (2005) Fruc-tose-induced fatty liver disease: hepatic effects of blood pressure and plasma triglyceride reduction. Hypertension 45:1012–1018.

doi:10.1161/01.HYP.0000164570.20420.67

10. Armutcu F, Coskun O, Gu¨rel A et al (2005) Thymosin alpha 1 attenuates lipid peroxidation and improves fructose-induced ste-atohepatitis in rats. Clin Biochem 38:540–547. doi:10.1016/j. clinbiochem.2005.01.013

11. Kanuri G, Spruss A, Wagnerberger S et al (2011) Role of tumor necrosis factor a (TNFa) in the onset of fructose-induced non-alcoholic fatty liver disease in mice. J Nutr Biochem 22:527–534.

doi:10.1016/j.jnutbio.2010.04.007

12. Haas JT, Miao J, Chanda D et al (2012) Hepatic insulin signaling is required for obesity-dependent expression of SREBP-1c mRNA but not for feeding-dependent expression. Cell Metab 15:873–884. doi:10.1016/j.cmet.2012.05.002

13. Collison KS, Maqbool ZM, Inglis AL et al (2010) Effect of dietary monosodium glutamate on HFCS-induced hepatic stea-tosis: expression profiles in the liver and visceral fat. Obesity (Silver Spring) 18:1122–1134. doi:10.1038/oby.2009.502

14. Dong X, Park S, Lin X et al (2006) Irs1 and Irs2 signaling is essential for hepatic glucose homeostasis and systemic growth. J Clin Invest 116:101–114. doi:10.1172/JCI25735

15. Kubota N, Kubota T, Itoh S et al (2008) Dynamic functional relay between insulin receptor substrate 1 and 2 in hepatic insulin signaling during fasting and feeding. Cell Metab 8:49–64. doi:10. 1016/j.cmet.2008.05.007

(10)

16. Zhao CX, Xu X, Cui Y et al (2009) Increased endothelial nitric-oxide synthase expression reduces hypertension and hyperinsu-linemia in fructose-treated rats. J Pharmacol Exp Ther 328:610–620. doi:10.1124/jpet.108.143396

17. Xu X, Zhao CX, Wang L et al (2010) Increased CYP2J3 expression reduces insulin resistance in fructose-treated rats and db/db mice. Diabetes 59:997–1005. doi:10.2337/db09-1241

18. Xu X, Tu L, Wang L et al (2011) CYP2J3 gene delivery reduces insulin resistance via upregulation of eNOS in fructose-treated rats. Cardiovasc Diabetol 10:114. doi:10.1186/1475-2840-10-114

19. Gonza´lez-Rodrı´guez A, Mas Gutierrez JA, Sanz-Gonza´lez S et al (2010) Inhibition of PTP1B restores IRS1-mediated hepatic insulin signaling in IRS2-deficient mice. Diabetes 59:588–599.

doi:10.2337/db09-0796

20. Baur JA, Pearson KJ, Price NL et al (2006) Resveratrol improves health and survival of mice on a high-calorie diet. Nature 444:337–342. doi:10.1038/nature05354

21. Lagouge M, Argmann C, Gerhart-Hines Z et al (2006) Resvera-trol improves mitochondrial function and protects against meta-bolic disease by activating SIRT1 and PGC-1alpha. Cell 127:1109–1122. doi:10.1016/j.cell.2006.11.013

22. Sheludiakova A, Rooney K, Boakes RA (2012) Metabolic and behavioural effects of sucrose and fructose/glucose drinks in the rat. Eur J Nutr 51:445–454. doi:10.1007/s00394-011-0228-x

23. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193:265–275

24. Towbin H, Staehelin T, Gordon J (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci U S A 76:4350–4354

25. Ouyang X, Cirillo P, Sautin Y et al (2008) Fructose consumption as a risk factor for non-alcoholic fatty liver disease. J Hepatol 48:993–999. doi:10.1016/j.jhep.2008.02.011

26. Brown MS, Goldstein JL (2008) Selective versus total insulin resistance: a pathogenic paradox. Cell Metab 7:95–96. doi:10. 1016/j.cmet.2007.12.009

27. Spruss A, Kanuri G, Uebel K et al (2011) Role of the inducible nitric oxide synthase in the onset of fructose-induced steatosis in mice. Antioxid Redox Signal 14:2121–2135. doi:10.1089/ars. 2010.3263

28. Kim F, Pham M, Maloney E et al (2008) Vascular inflammation, insulin resistance, and reduced nitric oxide production precede the onset of peripheral insulin resistance. Arterioscler Thromb Vasc Biol 28:1982–1988. doi:10.1161/ATVBAHA.108.169722

29. Pfluger PT, Herranz D, Velasco-Miguel S et al (2008) Sirt1 pro-tects against high-fat diet-induced metabolic damage. Proc Natl Acad Sci USA 105:9793–9798. doi:10.1073/pnas.0802917105

30. Ponugoti B, Kim D-H, Xiao Z et al (2010) SIRT1 deacetylates and inhibits SREBP-1C activity in regulation of hepatic lipid metabolism. J Biol Chem 285:33959–33970. doi:10.1074/jbc. M110.122978

31. Sun C, Zhang F, Ge X et al (2007) SIRT1 improves insulin sensitivity under insulin-resistant conditions by repressing PTP1B. Cell Metab 6:307–319. doi:10.1016/j.cmet.2007.08.014

32. Fro¨jdo¨ S, Durand C, Molin L et al (2011) Phosphoinositide 3-kinase as a novel functional target for the regulation of the insulin signaling pathway by SIRT1. Mol Cell Endocrinol 335:166–176. doi:10.1016/j.mce.2011.01.008

33. Deng J-Y, Hsieh P-S, Huang J-P et al (2008) Activation of estrogen receptor is crucial for resveratrol-stimulating muscular glucose uptake via both insulin-dependent and -independent pathways. Diabetes 57:1814–1823. doi:10.2337/db07-1750

34. Kang W, Hong HJ, Guan J et al (2012) Resveratrol improves insulin signaling in a tissue-specific manner under insulin-resis-tant conditions only: in vitro and in vivo experiments in rodents. Metabolism 61:424–433. doi:10.1016/j.metabol.2011.08.003

35. Zhang J (2006) Resveratrol inhibits insulin responses in a SirT1-independent pathway. Biochem J 397:519–527. doi:10.1042/ BJ20050977

36. Zeng G, Nystrom FH, Ravichandran LV et al (2000) Roles for insulin receptor, PI3-kinase, and Akt in insulin-signaling path-ways related to production of nitric oxide in human vascular endothelial cells. Circulation 101:1539–1545

37. Wang G-L, Fu Y-C, Xu W-C et al (2009) Resveratrol inhibits the expression of SREBP1 in cell model of steatosis via Sirt1-FOXO1 signaling pathway. Biochem Biophys Res Commun 380:644–649. doi:10.1016/j.bbrc.2009.01.163

38. Fujimoto M, Shimizu N, Kunii K et al (2005) A role for iNOS in fasting hyperglycemia and impaired insulin signaling in the liver of obese diabetic mice. Diabetes 54:1340–1348

doi:10.1111/j.1749-6632.2009.05266.x doi:10.1177/0963662511402281 doi:10.1038/ doi:10.1016/j.pbb.2010.02. 10.1016/j.fct.2012.03.061 doi:10.1016/j.fct.2013.07.026 1172/JCI34275 doi:10.1016/j.jnutbio.2011.09.006 10.1161/01.HYP.0000164570.20420.67 10.1016/j.clinbiochem.2005.01.013 10.1016/j.jnutbio.2010.04.007 doi:10.1016/j.cmet.2012.05.002 10.1038/oby.2009.502 doi:10.1172/JCI25735 1016/j.cmet.2008.05.007 10.1124/jpet.108.143396 doi:10.2337/db09-1241 10.1186/1475-2840-10-114 doi:10.2337/db09-0796 10.1038/nature05354 doi:10.1016/j.cell.2006.11.013 10.1007/s00394-011-0228-x doi:10.1016/j.jhep.2008.02.011 10.1016/j.cmet.2007.12.009 10.1089/ars.2010.3263 10.1161/ATVBAHA.108.169722 10.1073/pnas.0802917105 10.1074/jbc.M110.122978 doi:10.1016/j.cmet.2007.08.014 doi:10.1016/j.mce.2011.01.008 doi:10.2337/db07-1750 doi:10.1016/j.metabol.2011.08.003 doi:10.1042/ doi:10.1016/j.bbrc.2009.01.163

Şekil

Table 1 Body and liver weights, food, liquid and caloric intake amounts, liver triglyceride contents, plasma AST and ALT levels in rats from control, resveratrol, HFCS or resveratrol plus HFCS groups
Fig. 2 FASN (a), DGAT2 (b), CPT1a (c) and SREBP-1c (d) mRNA levels in the livers from control, resveratrol (Res), HFCS or resveratrol plus HFCS groups
Fig. 3 IRS-1 (a), eNOS (b), SIRT1 (c) and iNOS (d) mRNA levels in the livers from control, resveratrol (Res), HFCS or resveratrol plus HFCS groups

Referanslar

Benzer Belgeler

Gerçek adı Garip Tatar olan Ümit Kaftancıoğlu 1942 yılında ilkokula başlamış, ardından diğer kardeşleri gibi Cılavuz Köy Enstitüsüne girerek öğrencilik

Öte yandan dergi yay›mc›l›¤› için bir sistem tercihi yapacak olanlara, karar ver- mede yard›mc› olmas› bak›m›ndan ADS’deki dergi oluflturma ad›mlar›,

Acid alpha glucosidase (GAA) in dried blood spot was measured in each patient at two different university laboratories. LOPD was confirmed by mutation analysis in patients

Tarım kesimi için çiftçinin eline geçen fiyatlar indeksine göre iç ticaret hadleri incelendiğinde, çiftçilerin fiyatlardaki değişmelerden kuru fasulye ve

Selçuk Üniversitesi Tıp Fakültesi hemşirelerinde sigara içme durumu ve etkileyen faktörleri belirlemek için yapılan bir araştırmada hemşirelerin sigara içme

Geçen yıl Frankfurt Kitap Fuarı’na 16 Türk yayınevi katıldı.. Ayrıca oradaki bir yayınevinin çağrılısı olarak da dört yazarımız Frankfurt'a gitmişlerdi:

Single-side polished back-illuminated MQWs detec- tors exhibited a peak responsivity value as high as 0.054 A/W at 348 nm for svt1174, corresponding to 20% quantum efficiency..

Adsorpsiyona pH, adsorbent dozu, başlangıç boya konsantrasyonu ve sıcaklığın etkisi araştırılarak kaolin ile Remazol Brilliant Green 6B gideriminde optimum