Turkish Journal of Computer and Mathematics Education Vol.12 No.13 (2021), 6322-6326
Research Article
Identification of CBAVD Immunogenic Protein as Anti-Sperm Contraceptive Vaccine
1Maslichah Mafruchati, 2Jonathan Makuwira
1Department of Veterinary Anatomy, Faculty of Veterinary Medicine (60115), Universitas Airlangga, Mulyorejo, C Campus, Surabaya, Indonesia
2Malawi University of Science and Technology, P.O Box 5196, Limbe, Malawi.
1maslichah-m@fkh.unair.ac.id, 2jmakuwira@must.ac.mw
Abstract: The immune system (immune system) is the body's ability to fight infection, eliminating the action of toxins and other virulent factors that are antigenic and immunogenic. The antigen itself is a substance or compound that can stimulate the formation of antibodies. Antigens can be proteins, fats, polysaccharides, nucleic acids, lipopolysaccharides, lipoproteins, and others. Vaccine development based on the contraceptive approach is a promising vaccine. This study aimed to identify immunogenic proteins as the CBAVD vaccine. This research method is DNA extraction, PCR, sequencing, and bioinformatic analysis using Expasy and IEDB. The results of this study were found 6 types of protein translation results from nucleotides to protein and found 9 immunogenic proteins based on B cells. The conclusion from the results of this study is that CBAVD immunogenic protein is found and can be used as a candidate for the first contraceptive vaccine in Indonesia. Keywords: CBAVD, immunogenic protein, contraceptive vaccine.
Introduction
If we talk about infertility, then there is a fairly rare disease called CBAVD (congenital bilateral absence of vas deferens). This disease is a congenital disorder from birth, in which the advanced ducts of the epididymis or also called the vas deferens are not formed properly. It is triggered by a genetic disorder. One indication of CBVAD sufferers is cystic fibrosis (CF) (de Souza et al., 2018). Extensive investigation of the CFTR gene using the latest technology has shown that CBAVD is caused by mutations in two copies of the CFTR gene in 70-90% of cases depending on the ethnic/geographic population. The diagnosis of CBAVD is based on the incurable vas deferens on a scrotal examination performed by an andrologist. Testes are normal or below normal size. In some men, there is a palpable vas deferens in the scrotum, but surgical exploration reveals the presence of a non-permeable umbilical cord or duct (the lumen is not continuous as indicated by deferentography (Chiang et al., 2019). Analysis of semen shows that azoospermia (no visible sperm at ejaculation) with low semen volume (<1.0 ml), low pH (Mean <6.8), and low or no fructose. Besides, the occurrence of CBAVD in most people is associated with mutations in the CFTR gene (Mieusset et al., 2020). CBAVD can also occur without cystic fibrosis, but in only a minority of people. However, other things can trigger CBVAD without CF, namely one kidney is not formed or it is also called unilateral renal agenesis (URA) (Ferlin and Stuppia, 2020).
The immune system is the body's ability to fight infection, negating the action of toxins and other virulent factors that are antigenic and immunogenic (Agita and Alsagaff, 2017). The antigen itself is a substance or compound that can stimulate the formation of antibodies. Antigens can be proteins, fats, polysaccharides, nucleic acids, lipopolysaccharides, lipoproteins, and others. Meanwhile, antigenic is a characteristic of a compound that can stimulate the formation of specific antibodies against these compounds (Chinnasamy et al., 2011).
Immunogens are compounds that can stimulate the formation of immunity/immunity, and immunogenic are properties of compounds that can stimulate the formation of specific antibodies that are protective and increase cellular immunity (Zisapel et al., 2015). If the immune system is weakened, the ability to protect the body is also reduced, so that pathogens, including viruses, can grow and develop in the body. Meanwhile, the coordinated reaction of cells, molecules to microbes, and other substances is called an immune response. This study has an objective to identify immunogenic proteins as the CBAVD vaccine (Casals et al., 2000).
Research methods DNA extraction
This study uses PBMC culture cells with 103 cells in a volume of 200 µl buffer B3 (a mixture of B1 (containing Guanidine hydrochloride) and B2). They were incubated at 70 degrees Celcius for 10-15 minutes. The culture cells then is added with 210 µl of 96% ethanol and stirred in a vortex. The next step is to bind DNA, the mixture is put into the column then centrifuged 11,000 g for 1 minute (De la Cruz-Mosso et al., 2018).
The liquid below is then removed and washed 2 times, namely the first by adding 500 µl of buffer BW (Guanidine hydrochloride and isoprotenol<25%) then centrifuged 11,000 g for 1 minute then discarded, then for the second wash by adding 600 µl of buffer B5 then centrifuged 11,000 g for 1 minute, the liquid that entered the collecting tube was discarded (Plazonić et al., 2009). Re-centrifuge 11,000 g for 1 minute to clean ethanol,
then Coloum is put into a 1.5 ml Eppendorf tube. The next step is adding the 100 µl of elution buffer that has been warmed at 70 ° C and incubated for 1 minute, then 11,000 g is centrifuged for 1 minute (Nugraha et al., 2018).
PCR
The nucleotide base strands for the primer duplicated at this stage are as shown in the table below:
Table 1 Composition of CFRT Gene Primary Other primers
Primer Primer nucleotide arrangement
(Outher Primer Gene CFRT)
FORWARD CGAGAGACCATGCAGAGGTC RESERVE GCTCCAAGAGAGTCATACCA
Table 2. Composition of CFRT Inner Primer Gene primers
Primer Primer nucleotide arrangement
(Inner Primer Gene CFRT)
FORWARD CGAGAGACCATGCAGAGGTC RESERVE TGTACTGCTTTGGTGACTTCCCC
Sequencing
The PCR products of 15 µl were added respectively 37.5 µl sodium acetate 125 Mm Ph 8, 1.5 µl EDTA, 1.5 µl 3M Ph 5.2 and 125 Mm Ph 8. The mixture then vortexed and incubated at 4 ° C. The sample is stored in a refrigerator at a temperature (-20 ° C) and wrapped in aluminum foil to keep it away from light. The tool used is the ABI 3110 XL Capillary Sequencer (Garcia-Saez et al., 2018). The sequencing results in the form of a nucleotide sequence were translated into proteins using the Expasy software (Wardhana, 2020). The protein obtained, analyzed for immunogenic proteins using IEDB software, analysis of immunogenic proteins based on B cells (Khamesipour et al., 2014).
Results and Discussion
The results showed that six proteins were translated from nucleotides. The arrangement of the immunogenic protein and protein CBAVD based on B cells can be seen in table 3.
Table 3. Protein CBAD & Immunogenic Protein of CBAVD
No CBAVD protein Immunogenic Proteins Position Long
1 STQTPGQIQQDPISTKIKKLARCVDVCLW SQPTQEADLGPVESKRSRLQAMMVPLHS SLNEQEFL PGQIQQDPIST 5-15 11 WSQPTQEADLGPVESKRSRLQAM MVPLHSSLNE 29-61 33 2 VLRRLGKYSKTLSLQKKNPGVLMYACG PSLLRRLTWDDQLSPKGRGCSEPWCHYT PASTSKNF LGKYSKTLSLQKKNP 5-19 15 RLTWDDQLSPKGRGCSEPWCHYT PASTS 33-60 28 3 YSDAWANTARPYLYKNKKISQVCCMPV VPAYSGGLGMTSVQKVEAAVSHDGATT LQPQRARIS WANTARPYLYKNKKI 5-19 15 AYSGGLGMTSVQKVEAAVSHDG ATTLQPQRA 30-60 31 4 KFLLVEAGVWHHHGSLQPRPFGLNWSS QVSLLSRLGPQAYINTPGFFYFCRDRVLL YLPRRLST AGVWHHHGSLQPRPFGLNWSSQV SLLSRLGPQAYI 7-41 35 5 RNSCSLRLECSGTIMAHCSLDLLDSTGHP KSASVGWDHRHTSTHLANFFIFVEIGSCC ICPGVV LLDSTGHPKSASVGWDHRHTSTH L 22-45 24 6 EILARGWSVVAPSWLTAASTFWTQLVIP SQPPEAGTTGIHQHTWLIFLFLRGLAVFA QASEY ASTFWTQLVIPSQPPEAGTTGIH 18-40 23
The body's immune system has a purpose to create eliminate any pathogen or microorganism that can become the disease. When the immune system is working properly, in addition to responding subtly to invading pathogens, it also maintains its ability to recognize its tolerated antigens (van den Bosch et al., 2019). There are two kinds of immunity system, innate and adaptive. In general, it is stated that a person's immune response to pathogens consists of a natural or nonspecific immune response and an adaptive immune response or a specific immune response (Figure 2.1) (Hussein et al., 2011).
The human body's innate immune system cannot discover any pathogen, because there is only limited RNA code or antigen to create antibody. As a result, the immune system tries to create an adaptive immune system is mobilized through the hint of the innate response (Liu et al., 2008). B cells are cells that can form immunoglobulin (Ig) and constitute 5- 15% of circulating lymphocytes. B cells can recognize very low levels of antigens. This is because B cells have sIg (Surface immunoglobulin) which functions as a receptor for antigens (Takata et al., 2017).
(1) (2)
(2) (4)
Vaccine development based on the contraceptive approach is a promising vaccine. Based on the results of several studies that infertility can be related to the presence of anti-sperm antibody (ASA) in infertile partners, and 70% of vasectomy men form ASA. Study by state that ASA is a factor causing infertility. Besides, sperm cells have auto- and iso-antigenic potential and can produce an immune response in both men and women that is capable of causing infertility (AlMaghamsi et al., 2020).
The male genital tract will secrete IgG, IgA, and IgM immunoglobulin, with higher levels of IgG and IgA during ejaculation, in the process of ejaculation, most of the IgG comes from the circulation while IgA, which is represented by S-IgA. Immunoglobulin that causes contraceptive effects can be combined with antibodies against STDs to have a dual protective effect (Takata et al., 2017). Besides, immunoglobulin against various contraceptive target epitopes can be combined in one formulation to have strong and definite protection against pregnancy and disability but should not enhance autoimmune or anti-idiotypic immune responses. Azoospermia in CBAVD is diagnosed with clinical symptoms of azoospermia, pulmonary symptoms are characterized by chronic cough with sputum production, and then chronic obstruction of the lungs will occur, until it is diagnosed with chronic sinusitis and endocarditis (Mieusset et al., 2020).
Research conducted by Goldman and Green LH. (2013) In United States, men who suffer from azoospermia aged more than 10 years have a high risk of suffering from testicular cancer with a percentage of 15% of 4 million azoospermia sufferers aged between 15-45 years (Lin and Huang, 2020). The prevalence of azoospermia is a lot in the white race, this case has been carried out in a study at the andrology clinic of 2,238 infertile men, 451 men were azoospermia and 1,787 did not suffer from azoospermia. The discovery of immunogenic proteins is expected to be a new development in the CBAVD vaccine, especially those related to Azoospermia (Anzai et al., 2003).
Besides, with the discovery of immunogenic proteins based on B cells that can be used as the basis for the manufacture of contraceptive vaccines, immunoglobulins are the main secretion in the reproductive tract (Anzai et al., 2003).
Conclusion
From the results of the study, it was found that the immunogenic protein CBAVD and has the potential as a contraceptive vaccine for Azoospermia in Indonesia.
References
1. Agita, A., Alsagaff, M.T., 2017. Inflammation, immunity, and hypertension. Acta Med Indones 49, 158– 165.
2. AlMaghamsi, T., Iqbal, N., Al-Esaei, N.A., Mohammed, M., Eddin, K.Z., Ghurab, F., Moghrabi, N., Heaphy, E., Junaid, I., 2020. Cystic fibrosis gene mutations and polymorphisms in Saudi men with infertility. Ann. Saudi Med. 40, 321–329.
3. Anzai, C., Morokawa, N., Okada, H., Kamidono, S., Eto, Y., Yoshimura, K., 2003. CFTR gene mutations in Japanese individuals with congenital bilateral absence of the vas deferens. J. Cyst. Fibros. 2, 14–18. 4. Casals, T., Bassas, L., Egozcue, S., Ramos, M.D., Giménez, J., Segura, A., Garcia, F., Carrera, M.,
Larriba, S., Sarquella, J., 2000. Heterogeneity for mutations in the CFTR gene and clinical correlations in patients with congenital absence of the vas deferens. Hum. Reprod. 15, 1476–1483.
5. Chiang, H.-S., Wang, Y.-Y., Lin, Y.-H., Wu, Y.-N., 2019. The role of SLC9A3 in Taiwanese patients with congenital bilateral absence of vas deferens (CBAVD). J. Formos. Med. Assoc. 118, 1576–1583. 6. Chinnasamy, N., Wargo, J.A., Yu, Z., Rao, M., Frankel, T.L., Riley, J.P., Hong, J.J., Parkhurst, M.R.,
Feldman, S.A., Schrump, D.S., 2011. A TCR targeting the HLA-A* 0201–restricted epitope of MAGE-A3 recognizes multiple epitopes of the MAGE-A antigen superfamily in several types of cancer. J. Immunol. 186, 685–696.
7. De la Cruz-Mosso, U., García-Iglesias, T., Bucala, R., Estrada-García, I., González-López, L., Cerpa-Cruz, S., Parra-Rojas, I., Gámez-Nava, J.I., Pérez-Guerrero, E.E., Muñoz-Valle, J.F., 2018. MIF promotes a differential Th1/Th2/Th17 inflammatory response in human primary cell cultures: Predominance of Th17 cytokine profile in PBMC from healthy subjects and increase of IL-6 and TNF-α in PBMC from active SLE patients. Cell. Immunol. 324, 42–49.
8. De Souza, D.A.S., Faucz, F.R., Pereira‐Ferrari, L., Sotomaior, V.S., Raskin, S., 2018. Congenital bilateral absence of the vas deferens as an atypical form of cystic fibrosis: reproductive implications and genetic counseling. Andrology 6, 127–135.
9. Ferlin, A., Stuppia, L., 2020. Diagnostics of CFTR-negative patients with congenital bilateral absence of vas deferens: which mutations are of most interest?
10. Garcia-Saez, I., Menoni, H., Boopathi, R., Shukla, M.S., Soueidan, L., Noirclerc-Savoye, M., Le Roy, A., Skoufias, D.A., Bednar, J., Hamiche, A., 2018. Structure of an H1-bound 6-nucleosome array reveals an untwisted two-start chromatin fiber conformation. Mol. Cell 72, 902–915.
11. Hussein, Y.M., Gharib, A.F., Etewa, R.L., Amal, S., Abdel-Ghany, M.E., Elsawy, W.H., 2011. The melanoma-associated antigen-A3,-A4 genes: relation to the risk and clinicopathological parameters in breast cancer patients. Mol. Cell. Biochem. 351, 261–268.
12. Khamesipour, F., Noshadi, E., Moradi, M., Raissy, M., 2014. Detection of Vibrio spp. in shrimp from aquaculture sites in Iran using polymerase chain reaction (PCR). Aquac. Aquarium, Conserv. Legis. 7, 1– 7.
13. Lin, C.-H., Huang, T.-Y., 2020. Congenital bilateral absence of the vas deferens (CBAVD) with bilaterally present seminal vesicles. Urol. Case Reports 101131.
14. Liu, W., Cheng, S., Asa, S.L., Ezzat, S., 2008. The melanoma-associated antigen A3 mediates fibronectin-controlled cancer progression and metastasis. Cancer Res. 68, 8104–8112.
15. Mieusset, R., Bieth, E., Daudin, M., Isus, F., Delaunay, B., Bujan, L., Monteil, L., Fauquet, I., Huyghe, E., Hamdi, S.M., 2020. Male partners of infertile couples with congenital unilateral absence of the vas deferens are mainly non‐azoospermic. Andrology 8, 645–653.
16. Nugraha, A.P., Narmada, I.B., Ernawati, D.S., Dinaryanti, A., Hendrianto, E., Riawan, W., Rantam, F.A., 2018. Bone alkaline phosphatase and osteocalcin expression of rat’s Gingival mesenchymal stem cells cultured in platelet-rich fibrin for bone remodeling (in vitro study). Eur. J. Dent. 12, 566.
17. Plazonić, A., Bucar, F., Maleš, Ž., Mornar, A., Nigović, B., Kujundžić, N., 2009. Identification and quantification of flavonoids and phenolic acids in burr parsley (Caucalis platycarpos L.), using high-performance liquid chromatography with diode array detection and electrospray ionization mass spectrometry. Molecules 14, 2466–2490.
18. Takata, K., Reh, S., Yousefzadeh, M.J., Zelazowski, M.J., Bhetawal, S., Trono, D., Lowery, M.G., Sandoval, M., Takata, Y., Lu, Y., 2017. Analysis of DNA polymerase ν function in meiotic recombination, immunoglobulin class-switching, and DNA damage tolerance. PLoS Genet. 13, e1006818.
19. Van den Bosch, M.H., Ascone, G., Di Ceglie, I., Walgreen, B., Sloetjes, A.W., Lindhout, E., Bot, I., van de Loo, F.A., Koenders, M.I., van der Kraan, P.M., 2019. P073 High LDL levels lessen bone destruction during antigen-induced arthritis by inhibiting osteoclast formation and function.
20. Wardhana, A.K., 2020. Should be halal? is there any correlation between halal and vaccine? bibliography study in SCOPUS indexed academic paper. J. Halal Prod. Res. 3, 80–87.
21. Zisapel, M., Zisman, D., Madar-Balakirski, N., Arad, U., Padova, H., Matz, H., Maman-Sarvagyl, H., Kaufman, I., Paran, D., Feld, J., 2015. Prevalence of TNF-α blocker immunogenicity in psoriatic arthritis. J. Rheumatol. 42, 73–78.
