• Sonuç bulunamadı

The concomitant use of USP28 and p53 to predict the progression of urothelial carcinoma of the bladder

N/A
N/A
Protected

Academic year: 2022

Share "The concomitant use of USP28 and p53 to predict the progression of urothelial carcinoma of the bladder"

Copied!
5
0
0

Yükleniyor.... (view fulltext now)

Tam metin

(1)

Contents lists available atScienceDirect

Pathology - Research and Practice

journal homepage:www.elsevier.com/locate/prp

The concomitant use of USP28 and p53 to predict the progression of urothelial carcinoma of the bladder

Tuba Devrim

a,

*, Fatih Ataç

b

, Alparslan Kadir Devrim

c

, Mahi Balc ı

a

aDepartment of Pathology, Kırıkkale University Faculty of Medicine, Kırıkkale, 71450, Turkey

bDepartment of Urology, Kırıkkale University Faculty of Medicine, Kırıkkale, 71450, Turkey

cDepartment of Biochemistry, Kırıkkale University Faculty of Veterinary Medicine, Kırıkkale, 71450, Kırıkkale, Turkey

A R T I C L E I N F O

Keywords:

Bladder cancer USP28 p53 Invasion Progression Prognosis

A B S T R A C T

The Ubiquitin Specific Peptidase 28 (USP28) is a deubiquitinase involved in the DNA damage pathway. Recently, USP28 protein is reported to play roles in the mechanism of p53 action and could be a possible prognostic marker for bladder cancer (BCa). This study aims to explore the relation of USP28 with tumor growth and invasion, and also to investigate the interplay between USP28 and p53 in BCa. Expression levels of USP28 and p53 in human BCa (invasive and non-invasive, n = 43) and control tissues (n = 8) were evaluated by im- munohistochemistry and quantitative real-time polymerase chain reaction (qPCR) profiling. The relationship between protein and gene expression levels, clinicopathologic features and prognosis were evaluated. Significant positive correlations were found between BCa tumor progression and the USP28 expression, and also between the USP28 and p53 scores (p all < 0.05). Immunohistochemistry staining percentages were strongly correlated between USP28 and p53, and also positive correlations between tumor progression and p53 expressions were determined (p all < 0.001). Interestingly, USP28 and p53 were highly expressed and correlated in BCa.

Consequently, the immunohistochemistry and qPCR results reported in our study suggested the idea that USP28 in coordination with p53 could serve as a marker in BCa progression.

1. Introduction

Bladder cancer (BCa) is the most common malignancy of the urinary tract worldwide with high morbidity and mortality rates [1]. However, prognosis and treatment choices are primarily performed on clinical and pathological characteristics [2]. Thus, it is of great attention to determine novel molecular targets associated with progression and in- vasion of BCa, which might provide great advances in prognosis and identify a potential pathway for target therapy.

One of the most studied genes in cancer research is tumor sup- pressor p53. It is considered as“Guardian of the Genome” due to its role in the prevention of cancer [3]. p53 behaves as a transcription factor that protects the cells against various stress signals through activation of cellular pathways, like cell-cycle arrest, apoptosis, and senility; for this reason, it would be identified as a critical tumor suppressor [4].

Being a strong inductor of apoptosis, p53 protein is existed at a low level in normal cells. In response to various stress conditions, the p53 level is balanced through different post-translational modifications, which often arrange p53 binding through multiple feedback loops [5].

Ubiquitination is one of the most important post-translational

modifications, mediator in cancer-related pathways, and involved in cell-cycle progression, protein metabolism, transcription, and apoptosis [6]. USP28 is a deubiquitase that plays versatile roles in apoptosis [7].

Also, USP28 was reported to act directly to deubiquitinate and stabilize p53 [6]. Numerous studies have confirmed the ability of p53 to drive enhanced invasion of cancer cells [8]. Overexpression of USP28 was reported in various cancers, and marker potential of USP28 for BCa was expressed by a preliminary research [9].

Given these aforementioned studies, we speculated that, both USP28 and p53 would be in a joint action regulatory loop of apoptosis whereby p53 overexpression might promote USP28 synthesis, and thus increase the expression and transcription of USP28 target gene in BCa tissues. We further hypothesized that USP28 might reflect progression of BCa cells due to deubiquitination and stabilization process of p53.

Therefore, we investigated the clinical significance of USP28 expression levels alone and in coordination with p53 in human BCa.

https://doi.org/10.1016/j.prp.2019.152774

Received 9 July 2019; Received in revised form 30 November 2019; Accepted 1 December 2019

Corresponding author at: Department of Pathology, Kırıkkale University Faculty of Medicine, Kırıkkale, 71450. Turkey.

E-mail addresses:[email protected],[email protected](T. Devrim).

0344-0338/ © 2019 Elsevier GmbH. All rights reserved.

T

(2)

2. Materials and methods 2.1. Tissue collection

The samples were collected as surgically resected tissues from hos- pitalized patients by transurethral resection (TUR) or radical cy- stectomy (RC). A total of 51 formalin-fixed, paraffin embedded (FFPE) bladder tissues were retrospectively collected from Department of Pathology at Kırıkkale University Hospital, Turkey, between 2012 and 2018 years.

Haematoxylin and Eosin (H&E) stained sections from specimens were re-evaluated by two pathologists to confirm the diagnosis. The low and high grade cases were diagnosed according to WHO 2016 system [10]. Eight benign (control), 15 non-invasive low grades, 2 non-in- vasive high grades, 5 invasive low grades and 21 invasive high grade samples were included in our study groups. A total of three study groups (Group 1: control, n = 8; Group 2: non-invasive, n = 17; and Group 3: invasive, n = 26) were created. The data of patient demo- graphic features and clinicopathologic characteristics were collected from a database containing medical records and pathology reports. The protocols were approved by the ethics committee of Kırıkkale Uni- versity (Approval number: 24/12-12.12.2017).

2.2. Immunohistochemistry

Immunohistochemistry was performed on FFPE bladder specimens by using a Roche BenchMark® XT autostainer (Roche, Switzerland). Anti- USP28 and anti-p53 antibodies were used according to the manufac- turer's instructions (Table 1).

The semi-quantitative analyses of the immunohistochemistry staining were performed with the grading system based on number of positive cells in the investigated areas. For each sample, a total of 400 magnifications, each with a total of 100 grids (10 × 10) and a total of 0.025 mm2equal to 10 separate areas were examined. The percentages of strongly positive nuclear stained cells in each area were recorded and the average of these 10 sites was taken as the data of that patient [(0) with no positive stained cells; (1) poor staining (% 1–30); (2) medium staining (% 31–60); (3) intense staining (% 61–100)].

2.3. Real time quantitative reverse transcription polymerase chain reaction (qRT‐PCR)

Total RNA samples of control and BCa tissues were isolated from FFPE blocks using the FFPE RNA purification kit (25300, Norgen, Canada) following the manufacturer's protocol. RNA concentration and purity were assessed using NanoDrop equipment (Colibri, Titertek, Germany).

The cDNA synthesis reactions using 250 ng of template total RNA were performed with the RTPL12 Viva 2-Step kit (Vivantis, Malaysia) in a thermal cycler device (VERITI, Applied Biosystems, USA). Oligod(T) and random hexamer primers were used for the cDNA synthesis. The RNA primer mix was incubated at 65 °C for 5 min, and then stored at 4

°C for 10 min. At this stage, the cDNA synthesis mix was added to the tubes. They incubated at 25 °C for 10 min and 42 °C for 60 min. Finally, the enzyme was inactivated at 85 °C for 5 min and the process was completed.

In the qPCR stage, standard protocol of BrightGreen 2X qPCR MasterMix-No Dye kit (ABM, Canada) were performed. For this purpose,

initially, enzyme activation process was fulfilled for 10 min at 95 °C.

Subsequently, duplicate reactions were performed during 40 cycles; at 95 °C for 15 s and at 57−60 °C for 60 s in a Real-Time PCR device (Applied Biosystems, USA). The primer set of the study was detailed in Table 2.

Consequently, the relative quantifications of p53 and USP28 genes were determined using the comparative Ct method. TheΔΔCt was de- termined by subtracting theΔCt of the control group from the ΔCt of the BCa group values. Relative expression of the target genes were calcu- lated by the equation of 2^-ΔΔCt and p53 and USP28 levels were nor- malized to the housekeeping GAPDH [11].

2.4. Statistical analysis

Statistical analysis was performed using the Statistical Package for the Social Sciences (IBM, USA). Diff ;erences in expression levels were compared using the Mann-Whitney U test and Kruskal-Wallis test.

Categorical data were analyzed by Chi-squared test. Correlations of variables were computed with the Spearman rank correlation coeffi- cient. Differences between groups were determined by one-way analysis of variance (ANOVA). At 95 % confidence interval, p < 0.05 was con- sidered significant.

3. Results

3.1. Clinicopathologic features

Among the patients, 47 (92.2 %) were male, and 4 (7.8 %) were female. The mean age of all patients was 63 (42–92). Of the cases, 8 (15.7 %) were benign, 15 (29.4 %) were non-invasive low, 2 (3.9 %) were non-invasive high, 5 (9.8 %) were invasive low, and 21 (41.2 %) were invasive high grade. Muscle invasion was detected in two low- grade and two high-grade BCa patients.

The mean survival rate was 37.94 (3–144) months. Only one patient who was diagnosed as invasive high grade BCa, died at third month.

Body Mass Index (BMI) was 28.3 (18.2–37.4) and mean daily con- sumption of tobacco cigarettes was 16.5 (0–55) per day. None of the patients had a history of chemical exposure.

When the cases are grouped as normal, invasive and non-invasive;

17 (33.3 %) were non-invasive and, 26 (51 %) were invasive. There was a significant (p = 0.006) relation between invasive tumor and smoking groups. There was not any other significant relationship between smoking group and other parameters.

3.2. Immunohistochemical analysis

Both USP28 and p53 immunohistochemical expressions were in- creased in BCa tissues compared to control tissues as the invasion in- creased (Fig. 1). There was a statistically significant correlation be- tween USP28 and p53 expression scores and tumor progression (p = 0.048 and p = 0.012, respectively). USP28 was significantly increased in tumor groups compared to the controls. We determined a significant (+) correlation (r = 0.31, p = 0.024) between the invasive group and USP28 score. Additionally, a significant correlation was found between p53 and USP28 scores (r = 0.47, p < 0.001). There was no statistically significant relationship between clinicopathologic parameters, muscle invasion and expressions of USP28 and p53. The scores of im- munohistochemistry staining were listed inTable 3. Both USP28 and

Table 1

Details of the primary antibodies used for immunohistochemistry.

Antibody Clone Source Dilution Incubation (min) Positive Control

USP28 Polyclonal ABCAM ab70893 1/100 60 Kidney tissue

P53 Monoclonal ABCAM ab1101 1/75 60 Colon adenocarcinoma

(3)

p53 immunohistochemical expressions were increased as the invasion increased.

3.3. qPCR results

USP28 and p53 genes showed significant expression differences between normal bladder and BCa samples (Fig. 1). There was a Table 2

Primer sequences used for the qPCR analyses.

Target Gene Forward/

Reverse

Sequence (5'-3') Annealing Temperature °C Reference

USP28 F GCAAATGCTGGACACT 57 Guo et al., 2014 [9]

R ACTTCCTGCTCAAACC

p53 F GCCCAACAACACCAGCTCCT 60 Kumar and Mandal, 2019 [12]

R CCTGGGCATCCTTGAGTTCC

GAPDH F ACGACCACTTTGTCAAGCTC 59 Zehra et al., 2019 [13]

R GGTCTACATGGCAACTGAGA

Fig. 1. Immunohistochemical USP28 expression in control bladder mucosa ((A) x100), non-invasive low grade BCa ((B) x100), and invasive high grade BCa ((C) x200). Immunohistochemical p53 expression in control bladder mucosa ((D) x200), non-invasive low grade BCa ((E) x100), and invasive high grade BCa ((F) x200).

The intensity of USP28 and p53 expressions was gradually increased from control bladder mucosa to invasive cancer.

(4)

statistically significant relationship between USP28 gene and tumor progression (p = 0.009). Likewise, p53 gene was found to increase compared to controls as tumor progression increased (p = 0.021).

There was also a positive and statistically significant correlation be- tween p53 gene expression and tumor progression (r = 0.482; p = 0.002). When the relevance between these two genes was examined we found a significant (p = 0.024) relationship between p53 and USP28 expression levels. This relationship was confirmed with Wilcoxon Signed-Rank Test (p = 0.011) (Fig. 2).

4. Discussion

Although molecular diagnostic methods for many types of cancers have become indispensable parts of clinical diagnosis, BCa still has a lack of molecular diagnosis and has not been able to achieve wide- spread clinical use [14]. It is suggested that this uncertainty in the molecular mechanism of the disease is the most important cause of heterogeneity in response to BCa treatment [15]. To explore whether USP28 is involved in invasion of BCa cells, we also investigated p53 to scrutinize USP28 that would be a marker for migration, invasion, and metastasis of BCa cells.

Being a strong inductor of apoptosis, p53 protein is existed at a low level in normal cells. In response to various stress conditions, the p53 level is balanced through different posttranslational modifications [5].

Accordingly in the present study, we determined high p53 levels by immunohistochemistry and qPCR methods in both invasive and non- invasive BCa tissues compared to controls.

Aberrations in p53 levels have been reported for a variety of dif- ferent tumor types. Accumulation of the p53 protein has been linked with an unfavorable prognosis in BCa cases [16]. Also, malignant cancer cells with p53 mutations show a chemotherapy-resistant phe- notype. In response to various cellular stresses, p53 accumulates in the cell nucleus to administer the pro-apoptotic function. Activated p53 inhibits proliferation of cells with severe DNA damage by trans-acti- vation of target genes involved in induction of apoptosis. Therefore, the

binding activity of p53 to DNA provides the tumor suppression function [17]. However in about 50 % of all cancer types, p53 protein is either lost or changed. Therefore, this results in the expression of a tran- scriptionally inactive p53 protein and adversely affecting apoptosis [18]. Also, it is reported that disrupted p53 regulates other important stages of metastatic progression, such as cell migration and invasion [19]. In the present study, we demonstrated a highly significant re- lationship between tumor invasion and p53 levels as detected by im- munohistochemistry and qPCR. Thisfinding was consistent with other most recent studies [16,20–22] stating that stage of BCa is related to p53 increase, confirmed by immunohistochemical and molecular methods and emphasized the crucial function of the p53 tumor-sup- pressor gene protein in the development and for the progression of BCa.

USP28, a specific protease for ubiquitin, is an important regulator of oncogenes and tumor suppressors and can also promote cancer forma- tion [23]. The possible role of USP28 in the formation and/or pro- gression of BCa was reported by Guo et al. [9] and in most recent studies [20,24–26] there is a growing interest on the role of USP28 in BCa to obtain successful prognostication. We determined significant relationship between USP28 protein and gene expression levels and tumor invasion. This finding was consistent with other most recent studies [25,26]. As compared to p53, USP28 gene expression was in- creased more strongly in invasive than non-invasive cells, this suggests a direct correlation between invasion and USP28 expression. So we conclude that USP28 is not only required for p53-driven invasion but was also sufficient to maintain invasion after depletion of p53.

There is very limited data on p53 and USP28 correlation. Meitinger et al. [27] reported that USP28 and p53 genes could be related mole- cules; USP28, is essential for p53 activation in response to prolonged mitotic duration [27]. In a study performed on retinal pigment epi- thelial cell lines, USP28 was identified as essential component acting upstream of p53. It was also reported that USP28 can directly deubi- quitinate and stabilize p53 [6]. To the best of our knowledge, this is the first report describing the p53 and USP28 correlation for tumor inva- sion in BCa. We found a significant (p = 0.024) relationship between p53 and USP28 gene expression levels. This correlation could be a re- sult of deubiquitination and stabilization functions of USP28 on p53 in BCa cells and among these we conclude that USP28 would be an ef- fector of disrupted p53 activity in driving BCa invasion, and correlated with adverse prognosis in p53-expressing BCa patients.

In conclusion, immunohistochemistry approach for p53 is easy and widely available in the prognostic evaluation of BCa cases. Here we conclude that the additional use of USP28 immunohistochemistry staining with p53 would be a valuable option to interpret the prognosis and further prospective studies should be encouraged.

Authorship statement

Conception and design of study: T. Devrim, F. Ataç, A.K. Devrim, M Balcı

Acquisition of data: T. Devrim, F. Ataç, A.K. Devrim, M Balcı Analysis and/or interpretation of data: T. Devrim, F. Ataç, A.K.

Devrim, M Balcı Table 3

Immunohistochemistry staining scores.

Groups Scores Total number of cases

0 1 2 3

p53 Normal 0 3 (37.5 %) 5 (62.5 %) 0 8 (100.0 %)

Non-invasive 1 (5.9 %) 1 (5.9 %) 5 (29.4 %) 10 (58.8 %) 17 (100.0 %)

Invasive 1 (3.9 %) 6 (23 %) 5 (19.2 %) 14 (53.9 %) 26 (100.0 %)

USP28 Normal 2 (25.0 %) 5 (62.5 %) 1 (12.5 %) 0 (0.0 %) 8 (100.0 %)

Noninvasive 0 (0.0 %) 7 (41.2 %) 3 (17.6 %) 7 (41.2 %) 17 (100.0 %)

Invasive 2 (7.7 %) 6 (23.1 %) 6 (23.1 %) 12 (46.1 %)) 26 (100.0 %)

Fig. 2. 2^−ΔΔCt values of p53 and USP28 gene expressions with respect to GAPDH in bladder tissues determined by real-time PCR. Both parameters ex- hibited significant (p < 0.005) differences between the study groups.

(5)

Drafting the manuscript: T Devrim, A.K. Devrim;

Revising the manuscript critically for important intellectual content:

T Devrim, A.K. Devrim

Approval of the version of the manuscript to be published (the names of all authors must be listed):

T. Devrim, F. Ataç, A.K. Devrim, M Balcı Declaration of Competing Interest

The authors declared that they have no conflicts of interest related to this work.

Acknowledgements

This research (project no. 2018/023) was supported by Scientific Research Projects Office of Kırıkkale University. We thank our collea- gues Dr. Mahmut SOZMEN and Dr. Z. Sema OZKAN, who provided insight and expertise that greatly assisted the research.

References

[1] Z.F. Zhang, H.R. Zhang, Q.Y. Zhang, et al., High expression of TMEM40 is asso- ciated with the malignant behavior and tumorigenesis in bladder cancer, J. Transl.

Med. 16 (2018) 9.

[2] M.H. Baqai, M.S. Abomelha, K. Al Otaibi, M. Kourah, A. Al Elaiwai, Carcinoma bladder: 10 years experience at R.A.F.H, Urol. Ann. 8 (1) (2016) 16–52.

[3] D. Menendez, A. Inga, M.A. Resnick, The expanding universe of p53 targets, Nat.

Rev. Cancer 9 (10) (2009) 724–737.

[4] C.J. Brown, C.F. Cheok, C.S. Verma, D.P. Lane, Reactivation of p53: from peptides to small molecules, Trends Pharmacol. Sci. 32 (1) (2011) 53–62.

[5] N. Issaeva, p53 signaling in cancers, Cancers 11 (3) (2019) 332.

[6] C.S. Fong, G. Mazo, T. Das, J. Goodman, M. Kim, B.P. O’Rourke, D. Izquierdo, M.F. Tsou, 53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis, Elife 2 (5) (2016) pii: e16270.

[7] P.A. Knobel, R. Belotserkovskaya, Y. Galanty, C.K. Schmidt, S.P. Jackson, T.H. Stracker, USP28 is recruited to sites of DNA damage by the tandem BRCT domains of 53BP1 but plays a minor role in double-strand break metabolism, Mol.

Cell. Biol. 34 (11) (2014) 2062–2074.

[8] F. Mantovani, L. Collavin, G. Del Sal, Mutant p53 as a guardian of the cancer cell, Cell Death Differ. 26 (2) (2019) 199–212.

[9] G. Guo, Y. Xu, M. Gong, Y. Cao, R. An, USP28 is a potential prognostic marker for bladder cancer, Tumour Biol. 35 (2014) 4017–4022.

[10] H. Moch, P.A. Humphrey, T.M. Ulbright, V.E. Reuter, WHO Classification of Tumours of the Urinary System and Male Genital Organs, 4th edition, (2019).

[11] R.F. Kasem, D.S. Khater, G.A. Abdel-Latif, O.G. Shaker, Expression of miR-34a/p53

and their apoptotic target bax in oral squamous cell carcinoma, Int. J. Cancer Res.

14 (1) (2018) 32–38.

[12] J.P. Kumar, B.B. Mandal, Silk sericin induced pro-oxidative stress leads to apoptosis in human cancer cells, Food Chem. Toxicol. 123 (2019) 275–287.

[13] B. Zehra, A. Ahmed, R. Sarwar, A. Khan, U. Farooq, S. Abid Ali, A. Al-Harrasi, Apoptotic and antimetastatic activities of betulin isolated from Quercus incana against non-small cell lung cancer cells, Cancer Manage. Res. 11 (2019) 1667–1683.

[14] E. Xylinas, L.A. Kluth, M. Rieken, et al., Urine markers for detection and surveil- lance of bladder cancer, Urol. Oncol. 32 (2014) 222–229.

[15] R.L. Siegel, K.D. Miller, A. Jemal, Cancer statistics 2015, CA Cancer J. Clin. 65 (2015) 5–29.

[16] A. Liu, S. Zeng, X. Lu, Q. Xiong, Y. Xue, L. Tong, W. Xu, Y. Sun, Z. Zhang, C. Xu, Overexpression of G2 and S phase-expressed-1 contributes to cell proliferation, migration, and invasion via regulating p53/FoxM1/CCNB1 pathway and predicts poor prognosis in bladder cancer, Int. J. Biol. Macromol. 123 (2019) 322–334.

[17] T. Ozaki, A. Nakagawara, Role of p53 in cell death and human cancers, Cancers 3 (2011) 994–1013.

[18] P.A.J. Muller, K.H. Vousden, J.C. Norman, p53 and its mutants in tumor cell mi- gration and invasion, J. Cell Biol. 192 (2) (2011) 209–218 Jan 24.

[19] D. Walerych, K. Lisek, G. Del Sal, Mutant p53: one, No one, and one hundred thousand, Front. Oncol. 21 (5) (2015) 289.

[20] T. Heide, A. Maurer, M. Eipel, K. Knoll, M. Geelvink, J. Veeck, R. Knuechel, J. van Essen, R. Stoehr, A. Hartmann, J. Altmueller, T.A. Graham, N.T. Gaisa, Multiregion human bladder cancer sequencing reveals tumour evolution, bladder cancer phe- notypes and implications for targeted therapy, J. Pathol. 248 (2) (2019) 230–242.

[21] L. Yan, Q. Li, J. Yang, B. Qiao, TPX2-p53-GLIPR1 regulatory circuitry in cell pro- liferation, invasion, and tumor growth of bladder cancer, J. Cell. Biochem. 119 (2) (2018) 1791–1803.

[22] F. Vogiatzi, D.T. Brandt, J. Schneikert, J. Fuchs, K. Grikscheit, M. Wanzel, E. Pavlakis, J.P. Charles, O. Timofeev, A. Nist, M. Mernberger, E.J. Kantelhardt, U. Siebolts, F. Bartel, R. Jacob, A. Rath, R. Moll, R. Grosse, T. Stiewe, Mutant p53 promotes tumor progression and metastasis by the endoplasmic reticulum UDPase ENTPD5, Proc. Natl. Acad. Sci. U. S. A. 113 (52) (2016) E8433–E8442.

[23] S.M. Nijman, M.P. Luna-Vargas, A. Velds, et al., A genomic and functional inventory of deubiquitinating enzymes, Cell 123 (5) (2005) 773–786.

[24] J. Zhu, G. Huang, X. Hua, Y. Li, H. Yan, X. Che, Z. Tian, H. Liufu, C. Huang, J. Li, et al., CD44s is a crucial ATG7 downstream regulator for stem-like property, in- vasion, and lung metastasis of human bladder cancer (BC) cells, Oncogene 38 (2019) 3301–3315.

[25] Y. Luo, Z. Tian, X. Hua, M. Huang, J. Xu, J. Li, H. Huang, M. Cohen, C. Huang, Isorhapontigenin (ISO) inhibits stem cell-like properties and invasion of bladder cancer cell by attenuating CD44 expression, Cell. Mol. Life Sci. (2019),https://doi.

org/10.1007/s00018-019-03185-3.2019.

[26] J. Zhu, Y. Li, Y. Luo, J. Xu, H. Liufu, Z. Tian, C. Huang, J. Li, C. Huang, A feedback loop formed by ATG7/Autophagy, FOXO3a/miR-145 and PD-L1 regulates stem-like properties and invasion in human bladder cancer, Cancers (Basel) 11 (3) (2019) E349.

[27] F. Meitinger, J.V. Anzola, M. Kaulich, A. Richardson, J.D. Stender, C. Benner, C.K. Glass, S.F. Dowdy, A. Desai, A.K. Shiau, K. Oegema, 53BP1 and USP28 mediate p53 activation and G1 arrest after centrosome loss or extended mitotic duration, J.

Cell Biol. 214 (2) (2016) 155–166 18.

Referanslar

Benzer Belgeler

In the literature, tumor metastasis was detected in most of the cases with a diagnosis of sarcomatoid carcinoma in which lymph node was dissected, and tumor metastasis was detected

This study investigated the presence of HPV in larynx squamous cell carcinomas (SCC) via immunohisto- chemistry and polymerase chain reaction (PCR) array hybridization method and

The result of Western blotting demonstrated that the protein expression level of Bcl-2 markedly decreased after treatment with the 5-FU/PCA combination in AGS cells when compared

PATZ1 is a member of the transcription factor family of proteins that share an N terminal BTB/POZ (Broad Complex, Tramtrack, and Bric a' brac / Poxviruses and Zinc- finger (POZ)

The proposed method was applied to drinking water samples for determination of antimony; satisfactory results were

¸Sunu not etmek gerekir ki orjinal parametre vektörünün bir skalerden uyarlanır bir ¸sekilde elde edilmesi ek uyarlama düzeyi getirdi˘ginden da˘gıtılmı¸s a˘g üzerinde

Prior treatment of cells with cycloheximide or actinomycin D abolished the p53 increase and apoptosis induced by curcumin, suggesting that either de novo p53 protein synthesis or

Etkinliğin açılış konuşmasını yapan Türkiye Komü­ nist Partisi Merkez Komitesi üyesi Mehmet Kuzulu- gü, burada bir ölüyü değil, yaşayan bir insanı ve onun