• Sonuç bulunamadı

9-cis retinoic acid induces retinoid X receptor localized to the mitochondria for mediation of mitochondrial transcription

N/A
N/A
Protected

Academic year: 2021

Share "9-cis retinoic acid induces retinoid X receptor localized to the mitochondria for mediation of mitochondrial transcription"

Copied!
4
0
0

Yükleniyor.... (view fulltext now)

Tam metin

(1)

Biochemical and Biophysical Research Communications 377 (2008) 351–354

0006-291X/$ - see front matter © 2008 Else vier Inc. All rights reserved. doi:10.1016/j.bbrc.2008.09.122

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications

j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y b b r c

Mito chon dria have long been known to par tic i pate in cel lu lar energy metab o lism. The con tri bu tion of mito chon dria to reg u la-tion of cel lu lar aging, apop to sis, and devel op men tal pro cesses has recently attracted sig nif cant atten tion [1–3]. Sev eral recent stud ies have exam ined whether mito chon dria play impor tant roles in cell pro lif er a tion and dif fer en ti a tion, inde pen dent of their role in ATP pro duc tion [4,5]. Decreased num bers of mito chon dria or reduc tions in mtDNA tran scrip tion and trans la tion result in mito chon drial dys func tion and altered cel lu lar char ac ter is tics, as has been observed in var i ous cell types. For exam ple, MIN6 cells treated with ethi dium bro mide (EtBr) showed a marked decrease in the level of mtDNA and mRNAs tran scribed from it as well as impaired insu lin secre tion in response to glu cose [6]. Decreased mtDNA copy num ber has also been observed in renal can cer [7] and hepa to cel lu lar car ci noma [8]. In addi tion, Lewis [9] showed that a mutated poly mer ase gamma causes mtDNA deple tion and subsequent mito chon drial oxi da tive stress and car dio my op a thy. Fur ther more, sev eral stud ies have estab lished that many severe dis eases are induced by rear range ments of the mito chon drial genome [10,11]. Those reports high light the need for pre cise reg u-la tion of mito chon drial activ ity for nor mal cel lu u-lar phys i ol ogy.

Nuclear recep tors com prise a super fam ily of struc tur ally related tran scrip tion fac tors that reg u late a vari ety of cel lu lar pro-cesses. Recep tors for glu co cor ti coids [12], thy roid hor mones [13],

and the ret i noid recep tor X alpha (RXRa) [14] have been found in mito chon dria. Ret i noid recep tors, ret i noid X recep tor (RXR), and ret i noic acid recep tors (RARs) are mem bers of the ste roid/thy roid hor mone recep tor super fam ily. They func tion as ligand-depen dent tran scrip tion fac tors, and are involved in medi at ing ret i noid effects [15,16]. Sev eral stud ies sup port the hypoth e sis that nuclear recep-tors affect mito chon drial tran scrip tion by directly influ enc ing hor-mones that reg u late the mito chon drial tran scrip tion machin ery [17–20].

In a recent study, we found that RXRa is located not only in the nucleus, but also in the mito chon drial frac tion fol low ing ligand 9-cis RA-treat ment. 9-cis RA sig nif cantly induces RXRa expres sion and trans lo ca tion into mito chon dria. These results prompted us to exam ine how RXRa trans lo ca tion into mito chon dria con trib utes to mito chon drial activ ity.

Mate ri als and meth ods

Cell cul ture and drug treat ment. Oste o sar coma 143B thy mi dine

kinase-neg a tive (143B TK-) cells were grown in Dul becco’s mod i-fed Eagle’s medium (DMEM) sup ple mented with 10% fetal bovine serum (FBS), 100 U/ml pen i cil lin, and 100 lg/ml strep to my cin. Cells were grown for 3 days at 37 °C in a humid i fed atmo sphere with 5% CO2 before the start of exper i ments. Cells depleted of mtDNA

were cre ated using siR NA tar get ing the mito chon drial tran scrip-tion fac tor A (Tfam) gene, as pre vi ously described [21]. This siR NA down-reg u lates mtDNA tran scrip tion and rep li ca tion. 9-cis RA was

9-cis retinoic acid induces retinoid X receptor localized to the mitochondria

for mediation of mitochondrial transcription

Yung-Wei Lin

a

, Li-Ming Lien

b

, Tien-Shun Yeh

c

, Hsiao-Mei Wu

d

, Yi-Li Liu

d

, Rong-Hong Hsieh

d,*

a Depart ment of Urol ogy, Tai pei Med i cal Uni ver sity-Wan Fang Hos pi tal, 111, Sec tion 3, Hsing-Long Road, Tai pei 116, Tai wan, ROC b Depart ment of Neu rol ogy, Shin Kong Wu Ho-Su Memo rial Hos pi tal, 95, Wen-Chang Road, Tai pei 111, Tai wan, ROC

c Insti tute of Anat omy and Cell Biol ogy, Yang-Ming Uni ver sity, 155, Sec tion 2, Li nong Street, Tai pei 112, Tai wan, ROC d School of Nutri tion and Health Sci ences, Tai pei Med i cal Uni ver sity, 250 Wu-Hsing Street, Tai pei 110, Tai wan, ROC

a r t i c l e i n f o a b s t r a c t

Article history:

Received 22 September 2008 Available online 7 October 2008

We pre vi ously reported that 9-cis ret i noic acid (RA) treat ment induced an increase in mito chon drial (mt)DNA tran scrip tion. In order to extend these results, we tested var i ous con cen tra tions of 9-cis RA were used to treat 143B cells. Cells with low mem brane potential treated with 9-cis RA showed sig nif cantly lower amounts of RXRa in mito chon dria. We also found lower RXRa lev els in mtDNA-depleted cells. Treat ing cells with 9-cis RA sig nif cantly increased expres sion of ND1, ND6, and COX I RNA. How ever, 9-cis RA-treat ment did not appear to induce any sig nif cant changes in mtDNA copy num ber or mito chon drial mass. This study rep re sents that 9-cis RA increases mtDNA tran scrip tion but not mtDNA rep li ca tion, and it sug gests that the effects of 9-cis RA on mito chon dria are med i ated by RXR local i za tion to mito chon dria. In addi tion, this is the frst report that 9-cis RA reg u la tion of RXR mito chon drial trans lo ca tion depends on mito chon drial mem brane potential and ATP.

© 2008 Else vier Inc. All rights reserved. Key words:

9-cis ret i noic acid Mito chon drial bio gen e sis Ret i noid X recep tor

* Cor re spond ing author. Fax: +886 2 27373112.

(2)

352 Y.-W. Lin et al. / Biochemical and Biophysical Research Communications 377 (2008) 351–354 pur chased from Sigma-Aldrich (St. Louis, MO, USA) and dis solved

in EtOH accord ing to the lit er a ture and the man u fac turer’s instruc-tions. Cells were seeded in 96-well cul ture plates with var i ous con-cen tra tions of 9-cis RA. Con trol cells were cul tured in an equiv a lent con cen tra tion of car rier (0.1% EtOH), and no sig nif cant dif fer ence was found between cells grown in medium with or with out the car rier.

Deter mi na tion of mtDNA copy num ber and mito chon drial mass.

Lev els of mtDNA were deter mined by ampli f ca tion of the ND1 gene (59-GGAGTAATCCAGGTCGGT-39 and 59-TGGGTACAAT GA G GAG TAGG-39) and the GAP DH gene (59-AT CAAGAAGGTGGTGAAGC -39 and 59-CTGTAGCCAAATTCGTTGTC-39); the lat ter served as the inter nal stan dard. The poly mer ase chain reac tion (PCR) ampli f ca-tion pro fle was as fol lows: 1 cycle of 94 °C for 10 min; 35 cycles of 94 °C for 1 s, 62 °C for 5 s, and 72 °C for 10 s; and 1 cycle of 65 °C for 15 s, fol lowed by stor age at 4 °C. A Light Cycler PCR machine (Roche Diag nos tics, Mann heim, Ger many) was used to per form quan ti ta-tive PCR. The DNA con tent of the ND1 gene was nor mal ized to that of the GAP DH gene to cal cu late the copy num ber of mtDNA.

Mito chon drial mass was mea sured using the fluo res cent dye no nyl acri dine orange (NAO) (Molec u lar Probes, Eugene, OR), which binds to car di o lipin in the mito chon drial inner mem brane and which accu mu lates in mito chon dria regard less of the mito-chon drial mem brane potential. Cells grown to 70–80% con flu ence were tryp sin i zed and resus pended in 0.5 ml of phos phate-buf fered saline (PBS, pH 7.4) con tain ing 0.5 lM NAO. After incu ba tion for 15 min at 25 °C in the dark, cells were imme di ately trans ferred to a tube for anal y sis in a FACS Cal i bur sys tem (BD Bio sci ences, San Jose, CA, USA). The exci ta tion wave length was set at 488 nm and the inten sity of emit ted fluo res cence of a total of 10,000 cells at 525 nm was recorded. Data acqui si tion and anal y sis were per-formed using Cell Quest Pro Soft ware.

RNA extrac tion and real-time reverse-tran scrip tion (RT)-PCR anal-y sis. Total RNA was extracted from cells with the Tri zol reagent

accord ing to the man u fac turer’s instruc tions (Invit ro gen, Carls bad, CA, USA). Five micro grams of total RNA was reverse-tran scribed into cDNA using oligo (dT)18 (Pro tech Tech nol ogy, Tai pei, Tai wan)

as a primer and MMLV reverse trans crip tase (Epi cen tre Bio tech-nol ogy, Mad i son, WI, USA). The cDNA tem plate (5 ll) was sub se-quently used to amplify the dif fer ent mRNAs. A Light Cycler PCR machine (Roche Diag nos tics) was used to per form the real-time PCR. PCR con di tions were 94 °C for 5 min, fol lowed by 45 cycles of 94 °C for 10 s, 60 °C for 5 s, and 72 °C for 8 s. Prim ers were designed using Primer Express (Applied Bio sys tems). Sequences of the oli go nu cleo tide prim ers used in this study were: NADH dehy-dro ge nase sub unit 1 (ND1) (for ward, CCCAACCCTCTCCCTT ACA; reverse, ATT TGAGGCTCATCCCG), ND6 (for ward, CCAGC CAC CAC TATC ATTC; reverse, GAG TTGGTAGTGTTCTACTTGT), and glyc er al-de hyal-de 3-phos phate al-dehy dro ge nase (GAP DH) (for ward, GA GA GGCAATGAAAAGGTA; reverse, ACA TTGTTGCATCAGCTCAGGTCT).

Western blot anal y sis. Total pro tein was extracted from

har vested cells using lysis buffer (25 mM Tris-phos phate, pH 7.8, 2 mM DTT, 10% glyc erol, and 1% Tri ton X-100) with pro te ase inhib-i tors. The cell lysate was cleared of cell debrinhib-is by cen trinhib-i fu ga tinhib-ion at 10,000g for 5 min. The pro tein con cen tra tion was mea sured using a BCA pro tein assay kit (Pierce, Rock ford, IL, USA). Pro teins were resolved on SDS–poly acryl amide gels, and were then trans ferred onto a poly vi nyl i dene difluo ride (PVDF) mem brane (Amersham Pharmacia, Pis cat a way, NJ, USA). Mem branes were blocked for 1 h at 4 °C with 10% skim milk in TBST buffer (1 M Tris–HCl, 100 mM NaCl, and 1% Tween-20). Blots were probed with mono clo nal anti-bod ies (mAbs) against COX I (Molec u lar Probes, Eugene, OR, USA) and a poly clonal anti body against GAP DH. Blots were then incu-bated with the appro pri ate horse rad ish per ox i dase-con ju gated anti-immu no glob u lin G (IgG) anti body. Anti body-bound pro tein was detected using the Western blot ting chemi lu mi nes cence

lumi nol reagent (Santa Cruz, Santa Cruz, CA, USA) and expo sure to flm.

Results

9-cis RA induces RXRa expres sion and trans lo ca tion into the mito chon dria

To deter mine whether 9-cis RA-treat ment increases RXRa

expres sion and induces its trans lo ca tion into mito chon dria, lev els of RXRa in total cel lu lar and mito chon drial frac tions was deter-mined. 143B TK- cells were treated with 2, 5, or 10 lM 9-cis RA, and the RXRa expres sion was deter mined. We detected ele vated RXRa expres sion in cells treated with all three of these 9-cis RA con cen tra tions. Sig nif cantly increased RXRa expres sion was also observed in the mito chon drial frac tion of cells treated with 9-cis RA, regard less of the con cen tra tion (Fig. 1A).

RXRa trans lo ca tion into mito chon dria depends on mito chon drial mem brane potential

To char ac ter ize whether the mito chon drial mem brane potential affects 9-cis RA-induced RXRa trans lo ca tion into mito chon-dria, RXRa lev els in car bonyl cya nide m-chlo ro phenylhyd raz one (CCCP)-treated cells and mtDNA-depleted cells were deter mined. CCCP is an uncou pling reagent used to decrease the mito chon drial mem brane potential. The mtDNA-depleted cells were cre ated by decreas ing mtDNA tran scrip tion and rep li ca tion through siR NA knock down of the Tfam gene. Sig nif cantly decreased mito chon-drial mem brane potential and ATP pro duc tion were observed in both the CCCP-treated and the mtDNA-depleted cells (Table 1). Cells treated with 10 lM 9-cis RA together with 50 lM CCCP showed sig nif cantly decreased RXRa trans lo ca tion into the mito-chon dria. Cells depleted of mtDNA, which con tained 22 ± 18% of the nor mal amount of mtDNA, were also treated with 10 lM 9-cis-RA and showed reduced RXRa expres sion (Fig. 1B).

Fig. 1. 9-cis ret i noic acid (RA) induces ret i noid X recep tor (RXR)a expres sion. (A) 143B TK- cells were treated with 2, 5, or 10 lM 9-cis RA for 24 h. Lev els of RXRa in the total cel lu lar and mito chon drial frac tion were deter mined. mRXR, RXRa in the mito chon drial frac tion; C, con trol. (B) Ret i noid X recep tor (RXR)a trans lo ca tion into mito chon dria. Lev els of RXRa were deter mined in the mito chon drial frac tion of cells that had been incu bated with 10 lM 9-cis ret i noic acid (RA) for 24 h; RA+CCCP, cells treated with 10 lM 9-cis RA and 50 lM CCCP; RA+q¡, mtDNA-depleted cells treated with 10 lM 9-cis RA.

(3)

Y.-W. Lin et al. / Biochemical and Biophysical Research Communications 377 (2008) 351–354 353

RXRa trans lo ca tion into mito chon dria does not affect mtDNA or mito chon drion rep li ca tion

To deter mine whether RXRa trans lo ca tion into mito chon dria affects mtDNA or mito chon drial bio gen e sis, the mtDNA copy num-ber and mito chon drial mass were deter mined. Cells depleted of mtDNA had 22 ± 18% mtDNA of con trol cells. No sig nif cant dif fer-ences in the mtDNA copy num ber (Fig. 2A) or mito chon drial mass (Fig. 2B) were observed fol low ing 9-cis RA-treat ment.

Increased mtDNA tran scrip tion and trans la tion are induced by RXRa

located in mito chon dria

To deter mine whether RXRa trans lo ca tion into mito chon-dria affects mtDNA tran scrip tion or trans la tion, RNA and pro tein expres sion of mtDNAencoded genes were deter mined. Sig nif -cantly increased expres sion of ND1 and ND6 RNA was observed at all three con cen tra tions of 9-cis RA-treat ment (Fig. 3A). In addi-tion, 9-cis RA-induced an increase in COX I pro tein expres sion (Fig. 3B), but this effect was not observed in CCCP-treated or mtDNA-depleted cells (Fig. 3C).

Dis cus sion

The pres ent study found that 9-cis RA increases RXRa expres-sion in 143B cells. Impor tantly, RXRa was ele vated in the

mito-chon drial frac tion (Fig. 1A). A trun cated form of RXRa located in the mito chon drial matrix has been reported [22], and Ca sas et al. [14] iden ti fed a 44-kDa trun cated form of RXRa that is cleaved by a mito chon drial cal pain-like activ ity and trans lo cates into mito-chon dria. Both RXRa and TR3 trans lo ca tion into mito chon dria were observed in MGC80-3 gas tric can cer cells stim u lated by 9-cis RA [23]. All of these results indi cate that RXRa trans lo ca tion into Table 1

Cel lu lar char ac ter is tics and mito chon drial func tions of the cells stud ied. Cellsa mtDNAb,e Growthc

rate

Mor phol ogyd Mem branee

potential ATPe

pro duc tion

143B 100 +++ R 100 100 mtDNA- depleted cells 22 ± 18* ++ S 32 ± 14* 42 ± 16* CCCP-treated cells 104 ± 21 + S 12 ± 11* 8 ± 5*

a 143B, 143B thy mi dine kinase-neg a tive cells; mtDNA-depleted cells, cells with

low copy num ber of mtDNA pro duced through siR NA treat ment; CCCP-treated cells, cells with low mem brane potential caused by CCCP treat ment.

b The mtDNA copy num ber was deter mined by real-time PCR anal y sis. c +++, the growth rate is the same as the wild-type; ++, <60% of the wild-type; +,

<30% of the wild-type.

d R, rhom bus-like; S, spindle-like.

e mtDNA copy num ber, mem brane potential, and ATP pro duc tion are expressed

as a per cent age of to the val ues of non-treated con trol 143B cells. Data are expressed as means ± SD of three sep a rate exper i ments.

* p < 0.05, sig nif cantly dif fer ent from con trol cells.

Fig. 2. Deter mi na tion of the mito chon drial (mt)DNA copy num ber and mito chon drial mass. The mtDNA copy num ber and mito chon drial mass were deter mined from cells incu bated with 10 lM 9-cis ret i noic acid (RA) for 24 h; RA+CCCP, cells treated with 10 lM 9-cis RA and 50 lM CCCP; RA+q¡, mtDNA-depleted cells treated with 10 lM 9-cis RA. *p < 0.05, sig nif cantly dif fer ent from con trol cells.

Fig. 3. Expres sion lev els of mito chon drial (mt)RNA and pro tein. (A) Cells were treated with 2, 5, or 10 lM 9-cis ret i noic acid (RA) for 48 h. ND1 and ND6 gene expres sion was deter mined using real-time RT-PCR anal y sis. (B) Pro tein lev els of COX I were deter mined from cells treated with 2, 5, or 10 lM 9-cis RA for 48 h. (C) Pro tein lev els of COX I were deter mined from cells incu bated with 10 lM 9-cis RA for 24 h; RA+CCCP, cells treated with 10 lM 9-cis RA and 50 lM CCCP; RA+q¡, mtDNA-depleted cells treated with 10 lM 9-cis-RA. Data are expressed as means ± SD of three sep a rate exper i ments. *p < 0.05, sig nif cantly dif fer ent from con trol cells.

(4)

354 Y.-W. Lin et al. / Biochemical and Biophysical Research Communications 377 (2008) 351–354 mito chon dria depends on 9-cis RA, which is con sis tent with the

results of our study.

To eval u ate whether RXRa trans lo ca tion stim u lated by 9-cis RA depends on mito chon drial mem brane potential, cells were treated with 9-cis RA in com bi na tion with CCCP, or they were treated with 9-cis RA in con junc tion with mtDNA deple tion using siR NA. In cells co-treated with 9-cis RA and CCCP, RXRa trans lo ca tion into mito chon dria was sig nif cantly decreased (Fig. 1B). CCCP is a mito-chon drial uncou pler and is used to dis si pate the mito mito-chon drial mem brane potential [24,25]. Loss of mito chon drial mem brane potential fol low ing CCCP treat ment pre vented the trans lo ca tion of RXRa into the mito chon dria fol low ing treat ment with 9-cis RA. Reduced RXRa trans lo ca tion was also observed in mtDNA-depleted cells treated with 9-cis RA. Using car bon ylcy a nide p-trif-luoromethoxyphenylhyd raz one (FCCP), how ever, a pre vi ous study found that this uncou pling agent did not affect mito chon drial import of RXRa[14]. The high dose of CCCP and long incu ba tion time used in this study may explain why our results dif fer from those of the pre vi ous work.

We observed sig nif cantly decreased RXRa mito chon drial trans lo ca tion in mtDNA-depleted cells. These cells con tained less than 25% of the original mtDNA con tent, and their ATP pro duc tion was com pro mised as a result of dys func tional mito chon dria (Table 1). In fact, the reduced ATP pro duc tion appears to have dis rupted RXRa trans lo ca tion in the pres ent study. Con sis tent with our fnd-ings, Lin et al. [23] dem on strated that shut tling of RXRa is energy- and ligand-depen dent.

Sev eral exper i ments in var i ous sys tems have sug gested the pres ence of nuclear recep tors in mito chon dria that reg u late mito-chon drial tran scrip tion. For exam ple, glu co cor ti coid hor mone recep tors have been found to local ize to mito chon dria and to mod u late mito chon drial gene tran scrip tion in Hela cells [26] and in skel e tal muscle [17]. In MCF7 cells, ERa and ERb trans lo cated into mito chon dria and increased tran scrip tion of mtDNA-encoded genes was reported [18]. In addi tion, Ca sas et al. also pro vided con-vinc ing evi dence that over ex pres sion of the T3 recep tor stim u lates mito chon drial bio gen e sis in vitro [19] and in vivo [27].

In agree ment with pre vi ous work, we dem on strated that 9-cis RA induces RXRa trans lo ca tion into mito chon dria and increases lev els of mtDNA tran scrip tion and trans la tion. How ever, this trans-lo ca tion of RXRa did not affect mtDNA con tent or mito chon drial bio gen e sis, since we found no sig nif cant changes in mtDNA copy num ber or mito chon drial mass in the pres ent study. These exper-i men tal data pro vexper-ide con vexper-inc exper-ing evexper-i dence that 9-cexper-is RA exper-increases mtDNA tran scrip tion but not mtDNA rep li ca tion, which sug gests that RXR mito chon drial local i za tion, medi ates the effects of 9-cis RA on mito chon dria. Fur ther more, to our knowl edge, this is the frst report indi cat ing that trans lo ca tion of RXR into mito chon dria depends on ATP and on mito chon drial mem brane potential. Acknowl edg ments

The authors grate fully acknowl edge sup port from grant NSC95-2320-B-036-MY2 from the National Sci ence Coun cil of Tai wan, grant 94TMU-WFH-208 from Tai pei Med i cal Uni ver sity-Wan Fang Hos pi tal, and grant SKH-TMU-93-19 from Shin Kong Wu Ho-Su Memo rial Hos pi tal.

Ref er ences

[1] H.C. Lee, Y.H. Wei, Oxi da tive stress, mito chon drial DNA muta tion, and apop to-sis in aging, Exp. Biol. Med. 232 (2007) 592–606.

[2] S.Y. Jeong, D.W. Seol, The role of mito chon dria in apop to sis, BMB Rep. 41 (2008) 11–22.

[3] R. Du mol lard, M. Du chen, J. Car roll, The role of mito chon drial func tion in the oocyte and embryo, Curr. Top. Dev. Biol. 77 (2007) 21–49.

[4] M.J. Gold en thal, J. Marin-Gar cia, Mito chon drial sig nal ing path ways: a receiver/ inte gra tor orga nelle, Mol. Cell. Bio chem. 262 (2004) 1–16.

[5] A.M. Psarra, S. So lak id i, C.E. Se ke ris, The mito chon drion as a primary site of action of ste roid and thy roid hor mones: pres ence and action of ste roid and thy roid hor mone recep tors in mito chon dria of ani mal cells, Mol. Cell. Endo-cri nol. 246 (2006) 21–33.

[6] K. Tsu ruzoe, E. Araki, N. Furuk a wa, T. Shiro tan i, K. Mat sum ot o, K. Kane ko, H. Moto shi ma, K. Yo shiz ato, A. Shira ka mi, H. Kis hik a wa, J. Miya zaki, M. Shich-ir i, Cre a tion and char ac ter iza tion of a mito chon drial DNA-depleted pan cre atic beta-cell line: impaired insu lin secre tion induced by glu cose, leu cine, and sul-fo nyl u reas, Dia be tes 47 (1998) 621–631.

[7] P. Sel vanaya gam, S. Ra jar aman, Detec tion of mito chon drial genome deple-tion by a novel cDNA in renal cell car ci noma, Lab. Invest. 74 (1996) 592– 599.

[8] H.C. Lee, S.H. Li, J.C. Lin, C.C. Wu, D.C. Yeh, Y.H. Wei, Somatic muta tions in the D-loop and decrease in the copy num ber of mito chon drial DNA in human hepa to cel lu lar car ci noma, Mutat. Res. 547 (2004) 71–78.

[9] W. Lewis, B.J. Day, J.J. Koh ler, S.H. Hos se ini, S.S. Chan, E.C. Green, C.P. Ha ase, E.S. Keeb augh, R. Long, T. Lud away, R. Russ, J. Stelt zer, N. Tiol eco, R. San toi-an ni, W.C. Co pe ltoi-and, Decreased mtDNA, oxi da tive stress, car dio my op a thy, toi-and death from trans genic car diac tar geted human mutant poly mer ase gamma, Lab. Invest. 87 (2007) 326–335.

[10] Y.H. Wei, H.C. Lee, Mito chon drial DNA muta tions and oxi da tive stress in mito-chon drial dis eases, Adv. Clin. Chem. 37 (2003) 83–128.

[11] W. Mande mak ers, V.A. Mo rais, B. De Stroop er, A cell bio log i cal per spec tive on mito chon drial dys func tion in Par kin son dis ease and other neu ro de gen er a tive dis eases, J. Cell Sci. 120 (2007) 1707–1716.

[12] M.M. Ko uf ali, P. Mout sat sou, C.E. Se ke ris, K.C. Breen, The dynamic local i za tion of the glu co cor ti coid recep tor in rat C6 gli oma cell mito chon dria, Mol. Cell. Endo cri nol. 209 (2003) 51–60.

[13] F. Mor rish, N.E. Bu ro ker, M. Ge, X.H. Ning, J. Lo pez-Gu isa, D. Hoc ken bery, M.A. Port man, Thy roid hor mone recep tor iso forms local ize to car diac mito chon-drial matrix with potential for bind ing to recep tor ele ments on mtDNA, Mito-chon drion 6 (2006) 143–148.

[14] F. Ca sas, L. Da u ry, S. Grande mange, M. Bus son, P. Se yer, R. Ha tier, A. Ca razo, G. Ca bel lo, C. Wrut niak-Ca bel lo, Endo crine reg u la tion of mito chon drial activ ity: involve ment of trun cated RXR al pha and c-Erb Aal pha1 pro teins, FASEB J. 17 (2003) 426–436.

[15] P. Kast ner, M. Mark, P. Cham bon, Non ste roid nuclear recep tors: what are genetic stud ies tell ing us about their role in real life?, Cell 83 (1995) 859– 869.

[16] D.J. Man gels dorf, R.M. Evans, The RXR het ero di mers and orphan recep tors, Cell 83 (1995) 841–850.

[17] K. Weber, P. Bruck, Z. Mikes, J.H. Kup per, M. Klin gens por, R.J. Wies ner, Glu co-cor ti coid hor mone stim u lates mito chon drial bio gen e sis spe cif cally in skel e tal muscle, Endo cri nol ogy 143 (2002) 177–184.

[18] J.Q. Chen, M. Del an noy, C. Cooke, J.D. Yag er, Mito chon drial local i za tion of ER al-pha and ERb e ta in human MCF7 cells, Am. J. Phys iol. Endo cri nol. Metab. 286 (2004) E1011–E1022.

[19] F. Ca sas, P. Ro chard, A. Ro dier, I. Cas sar-Malek, S. Mar chal-Vic to ri on, R.J. Wies-ner, G. Ca bel lo, C. Wrut niak, A var i ant form of the nuclear tri i o do thy ro nine recep tor c-Er bA al pha1 plays a direct role in reg u la tion of mito chon drial RNA syn the sis, Mol. Cell. Biol. 19 (1999) 7913–7924.

[20] J.A. En ri quez, P. Fer nan dez-Silva, N. Garr i do-Perez, M.J. Lo pez-Perez, A. Perez-Mar tos, J. Mon toya, Direct reg u la tion of mito chon drial RNA syn the sis by thy-roid hor mone, Mol. Cell. Biol. 19 (1999) 657–670.

[21] J.Y. Jeng, T.S. Yeh, J.W. Lee, S.H. Lin, T.H. Fong, R.H. Hsieh, Main te nance of mito chon drial DNA copy num ber and expres sion are essen tial for pres er va-tion of mito chon drial func va-tion and cell growth, J. Cell. Bio chem. 103 (2008) 347–357.

[22] C. Wrut niak, I. Cas sar-Malek, S. Mar chal, A. Ra scle, S. Heus ser, J.M. Kel ler, J. Fle-chon, M. Da u ca, J. Sama rut, J. Ghysd ael, And et al., A 43-kDa pro tein related to c-Erb A alpha 1 is located in the mito chon drial matrix of rat liver, J. Biol. Chem. 270 (1995) 16347–16354.

[23] X.F. Lin, B.X. Zhao, H.Z. Chen, X.F. Ye, C.Y. Yang, H.Y. Zhou, M.Q. Zhang, S.C. Lin, Q. Wu, RXR al pha acts as a car rier for TR3 nuclear export in a 9-cis ret i noic acid-depen dent man ner in gas tric can cer cells, J. Cell Sci. 117 (2004) 5609– 5621.

[24] B. Schmidt, B. Hen nig, R. Zim mer mann, W. Neu pert, Bio syn thetic path way of mito chon drial ATP ase sub unit 9 in Neu ros pora crassa, J. Cell Biol. 96 (1983) 248–255.

[25] H. Rot ten berg, Uncou pling of oxi da tive phos phor y la tion in rat liver mito chon-dria by gen eral anes thet ics, Proc. Natl. Acad. Sci. USA 80 (1983) 3313–3317. [26] K. Scheller, C.E. Se ke ris, G. Kro hne, R. Hock, I.A. Han sen, U. Scheer, Local i za tion

of glu co cor ti coid hor mone recep tors in mito chon dria of human cells, Eur. J. Cell Biol. 79 (2000) 299–307.

[27] F. Ca sas, L. Pesse messe, S. Grande mange, P. Se yer, N. Gueg u en, O. Baris, L. Lep-ourry, G. Ca bel lo, C. Wrut niak-Ca bel lo, Over ex pres sion of the mito chon drial T3 recep tor p43 induces a shift in skel e tal muscle fber types, PLoS ONE 3 (2008) e2501.

Referanslar

Benzer Belgeler

Cells with low membrane potential treated with 9-cis RA showed significantly lower amounts of RXRα in mitochondria.. We also found lower RXRα levels in

As the concentration of 9-cis RA increased, the levels of mRNA expression of the nuclear DNA-encoded retinoid X receptor α (RXRα) and mitochondrial transcription factor A (mtTFA)

As the concentra tion of 9-cis RA increased, the levels of mRNA expression of the nuclear DNA-encoded retinoid X receptor α (RXRα) and mi tochondrial transcription factor A (mtTFA)

In Section 3.1 the SIR model with delay is constructed, then equilibrium points, basic reproduction number and stability analysis are given for this model.. In Section

This work covered Brahmo-Samaj Movement, Arya-Samaj Movement and Rama Krishna Movement; (2) Sanayal, Meera (1986) worked on &#34;Rama Krishan Mission and its impact on

Muhammad, Shan (1999) wrote a book entitled, &#34;The Aligarh Movement (A Concise Study)&#34;.'*« in this book he gave a biographical account of Sir Syed Ahmad Khan, The Revolt

The T-test results show significant differences between successful and unsuccessful students in the frequency of using the six categories of strategies except

Burada beklenen enfeksiyon sayısı benzer hastane ve benzer enfeksiyon tipinde ortalama olarak hesaplanan bir rakamdır ve ülkemiz için Ulusal Hastane Enfeksiyonları Surve- yans