• Sonuç bulunamadı

Chymase mediates paraquat-induced collagen production in human lung fibroblasts.

N/A
N/A
Protected

Academic year: 2021

Share "Chymase mediates paraquat-induced collagen production in human lung fibroblasts."

Copied!
7
0
0

Yükleniyor.... (view fulltext now)

Tam metin

(1)

Toxicology Letters xxx (2009) xxx–xxx

Contents lists available at

ScienceDirect

Toxicology Letters

j o u r n a l h o m e p a g e :

w w w . e l s e v i e r . c o m / l o c a t e / t o x l e t

Chymase mediates paraquat-induced collagen production in human

lung fibroblasts

Yaw-Dong Lang

a

, Shwu-Fen Chang

a

, Leng-Fang Wang

b

,

1

, Chung-Ming Chen

c

,

∗

,

1

aGraduate Institute of Medical Sciences, Taipei Medical University, Taipei 110, Taiwan

bDepartment of Biochemistry, Taipei Medical University, Taipei 110, Taiwan cDepartment of Pediatrics, Taipei Medical University Hospital, Taipei 110, Taiwan

a r t i c l e i n f o

Article history:

Received 23 July 2009

Received in revised form 8 October 2009 Accepted 2 December 2009 Available online xxx Keywords: Angiotensin Angiotensin-converting enzyme siRNA

a b s t r a c t

Survivors of paraquat poisoning may be left with pulmonary fibrosis and a restrictive type of pulmonary dysfunction. Chymase converts angiotensin (Ang) I to Ang II, which is closely involved with lung fibrosis. The role played by chymase in paraquat-induced lung fibrosis is unclear. We examined the effects of paraquat on chymase, renin–angiotensin system components, and collagen expression in murine and human lung fibroblasts (MRC-5). Lung chymase and collagen type I mRNA and protein expression were significantly increased and angiotensin-converting enzyme (ACE) mRNA and protein expression were comparable between the control and paraquat-treated mice 1 and 3 weeks after administration. Paraquat significantly upregulated angiotensinogen mRNA expression in a dose-dependent manner while ACE activity and protein expression were similar in MRC-5 cells. Furthermore, paraquat enhanced Ang II and collagen type I mRNA and protein expression,␣-smooth muscle actin, and chymase protein and chymase small interfering RNA inhibited these effects. The cDNA sequence of chymase in MRC-5 cells is identical to that in human mast cells. This study found increased chymase expression in paraquat-treated human lung fibroblasts and confirmed in vitro and in an in vivo paraquat model of lung fibrosis that chymase generates Ang II and enhances collagen expression. These data suggest a role for chymase in the pathogenesis of paraquat-induced lung fibrosis.

© 2009 Elsevier Ireland Ltd. All rights reserved.

1. Introduction

Paraquat dichloride (1,1



-dimethyl-4,4



-bipyridilium

dichlo-ride) is an effective and widely used herbicide. The intentional

and accidental ingestion of commercial liquid formulations of

paraquat has caused a large number of human fatalities. According

to epidemiological data in the National Poison Center in

Tai-wan during 1985 and 1997, paraquat poisoning was the leading

cause of poisoning-induced death in Taiwan (

Satoh and Hosokawa,

2000

). The lungs are one of the primary target organs in

paraquat-produced toxicity in humans (

Dinis-Oliveira et al., 2008

). The acute

toxic effects of paraquat are pulmonary edema, hypoxia, and

res-piratory failure. Survivors of paraquat poisoning may be left with

pulmonary fibrosis that results in a restrictive type of long-term

pulmonary dysfunction (

Yamashita et al., 2000

).

Chymase is a chymotrypsin-like serine protease that is stored

in secretory granules of mast cells. One of the major functions of

chymase is to convert angiotensin (Ang) I to Ang II, which is believed

∗ Corresponding author. Tel.: +886 2 27372181; fax: +886 2 27360399. E-mail address:[email protected](C.-M. Chen).

1L.F. Wang and C.M. Chen contributed equally to this work.

to play an important role in the pathogenesis of lung fibrosis (

Urata

et al., 1990; Tomimori et al., 2003; Marshall et al., 2004; Orito et al.,

2004; Sakaguchi et al., 2004

). It is well known that mast cells store

and release chymase which catalyzes the transformation of Ang I

into Ang II, and then Ang II stimulates fibroblast proliferation (

Reid

et al., 2007

). However, it is not known whether chymase is produced

by lung fibroblasts and the mechanisms by which paraquat induces

lung fibrosis. The aims of this study were to investigate the effects of

paraquat on lung chymase, angiotensin-converting enzyme (ACE),

and collagen expression in mice and to evaluate the role of chymase

in paraquat-induced lung fibrosis by measuring renin–angiotensin

system components and collagen in human lung fibroblasts.

2. Materials and methods

2.1. Animals

A total of 27 male C57BL/6 mice (8–10-week old) were purchased from Bio-LASCO Technology (Charles River Taiwan Ltd). All mice received standard animal care under the supervision of Institutional Animal Care and Use Committee at Taipei Medical University. The mice were caged in an air-conditioned animal facility with food and water available ad libitum in a room maintained under constant temper-ature and humidity conditions with a 12:12 light–dark cycle. The mice were given intraperitoneally (i.p.) paraquat 20 mg/kg or an equivalent volume of sterile-filtered phosphate-buffered saline (PBS). One and 3 weeks after paraquat treatment, mice 0378-4274/$ – see front matter © 2009 Elsevier Ireland Ltd. All rights reserved.

(2)

Primers used for real-time PCR in mice.

Primer Sequence 5→ 3 Accession no.

ACE 479CAGAATCTACTCCACTGGCAAGGT502 NM207624 576TTCGTGAGGAAGCCAGGATGT556 Chymase 183AGCTGGAGAGATCATTGGAG202 NM010780 282GCAGGCCGACAGGTAGTTCT263 Collagen I 232AAACCCGAGGTATGCTTGATCTGTA256 NM007742 406GTCCCTCGACTCCTACATCTTCTGA382 GADPH 97GAATGGGAAGCTTGTCATCAACGG120 XM983502 204GTAGACTCCACGACATACTCAGCAC180

were euthanized i.p. with 50 mg/kg pentobarbital and decapitated. Six mice were used for control group and 8 and 7 mice were used for 1 and 3 weeks paraquat-treated groups, respectively. All mice survived in the control and paraquat-paraquat-treated groups.Cell culture

MRC-5 cells (human lung fibroblasts; ATCC, Manassas, VA, USA) were main-tained in Dulbecco’s minimal essential medium (DMEM, Gibco, Grand Island, NY, USA) supplemented with 100 U/ml penicillin, 100␮g/mL streptomycin, and 10% heat-inactivated fetal calf serum (FCS; Gibco), and incubated at 37◦C in 5%

CO2. Fibroblasts between passages 25 and 35 were used for all experiments. For

collagen expression induced by paraquat, 50␮g/mL ascorbic acid and 50 ␮g/mL ␤-aminopropionitrile fumarate (Sigma–Aldrich, Saint Louis, MO, USA) were added to the culture medium. Cells were grown to confluence and then serum-starved in DMEM containing 0.2% FCS for 24 h before stimulation with drugs. The cytotoxic effects of paraquat on incubated MRC-5 cells were measured using the 3-(4,5-methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay over a range of doses (100–900␮M) for 48 h. The cell viability was maintained at ∼90% below 500␮M paraquat, but decreased significantly above 700 ␮M paraquat. Therefore, paraquat concentrations between 0 and 500␮M were used in this study. 2.3. Real-time PCR

The abundance of mRNA was determined by reverse transcription, followed by real-time PCR using appropriate primers (Tables 1 and 2). Total RNA was extracted using TRIzol Reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) and treated with RNAase-free DNAase (Sigma–Aldrich). Two microgram of total RNA and oligo (dT) were used to synthesize cDNAs with a First-Strand cDNA Synthesis Kit (GE Healthcare, Piscataway, NJ, USA). Gene expression was quantified by SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and carried out using the ABI Prism 7300 Sequence Detection System. The relative quantitation of gene expression was normalized to GAPDH or 18S rRNA as internal standard. Triplicate experiments were done for each sample.Collagen assay

Total soluble collagen was measured in murine lung tissue and cultured super-natant using the Sircol Collagen Assay Kit (Biocolor, Belfast, UK). Briefly, 0.3 ml of Sirius dye reagent was added to an equal volume of test sample and mixed for 30 min at room temperature. The collagen-dye complex was precipitated by centrifugation and dissolved in 0.5 M sodium hydroxide; the absorbance was measured at 540 nm. The collagen level in each specimen was obtained as an average of three readings. 2.5. Western blotting analysis

Proteins were separated on 12% SDS-polyacrylamide gel, and electrophoretically transferred onto polyvinylidene fluoride membrane. The primary antibodies used in this study were mouse anti-ACE (1:100; Santa Cruz Biotechnology, Santa Cruz, CA, USA), mouse chymase (1:1,000; Abcam, Cambridge, MA, USA), mouse anti-␣-smooth muscle actin (␣-SMA) (1:10,000; Sigma–Aldrich), rabbit anti-collagen type I (1:2,500; Abcam) and mouse anti-␤-actin (1:100,000; Sigma–Aldrich). After incubation with the primary antibody, the membranes were probed with the appropriate horseradish peroxidase-conjugated secondary antibody (anti-mouse or anti-rabbit, 1:20,000; Pierce, Rockford, IL, USA). Immune complexes were visu-alized using ECL plus detection reagents (Pierce). Quantitative comparison of the fluorescent images was achieved with a densitometer. Densitometric analysis was performed to measure the intensity of all Western Blotting bands using AIDA

soft-Table 2

Primers used for real-time PCR in MRC-5 cell culture.

Primer Sequence 5→ 3 Accession no.

Angiotensinogen 237CACCTCGTCATCCACAATGAGA258 NM000029 343GATGTCTTGGCCTGAATTGG324 Chymase 666GGCCCAGGGCATCGTATC684 NM001836 782CAGGATTAATTTGCCTGCAGG4481 Collagen I 1303GTGCTAAAGGTGCCAATGGT1322 NM000088 1430ACCAGGTTCACCGCTGTTAC1411

18S rRNA 70GGACACGGACAGGATTGACA89 AJ844646 119ACCCACGGAATCGAGAAAGA100

Germany). 2.6. Angiotensin II

The quantitative measurement of Ang II in culture supernatant was measured by an ELISA kit (Phoenix Pharmaceuticals, Burlingame, CA, USA). Briefly, the stan-dards or samples were incubated with anti-Ang II antibody and biotinylated Ang II. After incubation, the bound biotinylated Ang II was determined by means of its reaction with streptavidin–horseradish peroxidase using tetramethyl benzidine dihydrochloride and hydrogen peroxide as a substrate. The reaction was termi-nated with 2N HCl, and the color intensity was measured at 450 nm using an ELISA microtiter plate reader.

2.7. ACE activity

ACE activity was measured using a commercially available kit according to the manufacturer’s instructions (Bühlmann Laboratories, Schönenbuch, Switzerland). Briefly, cell lysates were incubated with N-hippuryl-l-histidyl-l-leucine as sub-strate, and the released hippuric acid was then complexed with cyanuric chloride, and this complex was measured at 382 nm. Samples were measured in triplicate and quantitated by comparison to standards.Immunofluorescence and confocal microscopy

Samples were fixed in 4% para-formaldehyde and blocked with bovine serum albumin. Samples were then incubated with proper primary antibodies (mouse anti-chymase, mouse anti-␣-SMA, or rabbit anti-tryptase (1:100, Santa Cruz Biotechnology) for 16 h. Indirect immunolabeling was performed by incubation with an FITC-conjugated anti-mouse IgG antibody (1:400, Zymed, San Francisco, CA, USA) and a Cy3-conjugated rabbit IgG antibody (1:200, Zymed) as the secondary anti-bodies for 1 h. 4,6-Diamidino-2-phenylindole (DAPI, Sigma–Aldrich) was used for nuclear staining. Images of marked cells were captured with a confocal microscope (Leica Microsystems, Exton, PA, USA).

2.9. Generation and transfection of small interfering RNA (siRNA)

The two pairs of primers for the amplification of the chymase siRNA were as follows: sense: 5-CATGGCCTACCTGGAAATTG-3 and antisense: 5 -TCAAGCTTCTGCCATGTGTC-3; and sense: 5-TGCAAGAGGTGAAGCTGAGA-3, and antisense: 5-GTAATGGGAGATTCGGGTGA-3. Purified PCR products were

tran-scribed using the X-tremeGENE siRNA Dicer Kit (Roche Applied Science,

Fig. 1. Effects of paraquat treatment on (A) chymase, (B) angiotensin-converting enzyme (ACE), and (C) type I collagen mRNA expressions in mouse lung. Chymase and type I collagen mRNA expressions were significantly increased while ACE mRNA expressions were comparable between the control and paraquat-treated mice 1 and 3 weeks after paraquat treatment. Data are presented as the mean± S.D. (n = 5). *p < 0.05 versus control mice at the corresponding time point.

(3)

Y.-D. Lang et al. / Toxicology Letters xxx (2009) xxx–xxx 3 Indianapolis, IN, USA). The resulting double-stranded RNA was digested with

bac-terial RNase III (Roche Applied Science). MRC-5 cells were seeded into 6-well plates and cultured with 40% DMEM and 40% opti-MEM (Invitrogen Life Technologies) supplemented with 10% FBS without antibiotics 2 days before transfection. When 50% confluence was reached, the chymase and Silencer®negative control (scramble) siRNA (Ambion Inc., Austin, TX, USA) were transfected with Lipofectamine RNAiMAX (Invitrogen Life Technologies) 24 h before the administration of paraquat. 2.10. cDNA sequencing

Human lung fibroblast chymase cDNA was obtained by RT-PCR amplifi-cation of total RNA. Reverse transcription of each RNA sample was carried out using a First-Strand cDNA Synthesis Kit (GE Healthcare). The chymase primers (sense 5-GGCAGCCTCTCTGGGAAG ATGCTGCTTCTTC-3 and antisense

Fig. 2. Effects of paraquat treatment on (A) chymase, (B) angiotensin-converting

enzyme (ACE), and (C) type I collagen protein expressions in mouse lung. Chymase and type I collagen protein were significantly increased while ACE were comparable between the control and paraquat-treated mice 1 and 3 weeks after paraquat treat-ment. Data are presented as the mean± S.D. (n = 4). *p < 0.05 and **p < 0.01 versus control mice at the corresponding time point.

5-ATTTGCCTGCAGGATCTGGTTGATCCAGGGC-3) were designed based on NCBI accession no.: M64269. The amplification profile generated a 769-base pair full-length chymase cDNA. The PCR products were purified by QIAquick PCR Purification Kit (Qiagen, Valencia, CA, USA) and analysed using an ABI 3730 automated DNA sequencer (Applied Biosystems). The human lung fibroblast sequencing results were then matched with those from the sequencing of the human mast cell chymase sequencing (accession no.: M64269) by the NCBI Basic Local Alignment Search Tool (BLAST) (http://www.ncbi.nlm.nih.gov/BLAST).

2.11. Transforming growth factor-ˇ1 (TGF-ˇ1) assay

Active TGF-␤1 levels were measured in conditioned media using an ELISA kit (R&D, Minneapolis, MN, USA) according to the manufacturer’s instructions and samples were measured in triplicate and quantitated by comparison to standards. To study the role of Ang II pathway in paraquat-induced collagen production, MRC-5 cells were treated with anti-Ang II antibody (5␮g/ml, Phoenix Pharma-ceuticals, Burlingame, CA, USA) for 48 h to analyze its effect on active TGF-␤1 levels.

2.12. Statistical analysis

Data are expressed as the mean± S.D. Comparisons between control and paraquatreated mice at each time point were made using unpaired Student’s t-test. Analysis of difference among multiple groups in cell cultures was evaluated by one-way ANOVA with post hoc Turkey’s test. A p-value of <0.05 was considered statistically significant.

3. Results

3.1. Paraquat increases chymase,

˛-SMA, and collagen type I

mRNA and protein expression but does not alter ACE mRNA and

protein expression in mouse lung

In this study, we measured only type I collagen expression

because it constitutes greater than 65% of the total lung

colla-gen in normal human lung (

Cairns and Walls, 1997

). Chymase

and type I collagen mRNA and protein expression were

signifi-cantly increased whereas ACE mRNA and protein expression were

comparable between the control and paraquat-treated murine

lung 1 and 3 weeks after paraquat treatment (

Figs. 1 and 2

).

Paraquat treatment significantly increased total lung collagen

con-tents 1 and 3 weeks after administration when compared with

the control group (

Fig. 3

). Control mice displayed faint staining

for chymase and paraquat treatment increased chymase and

␣-SMA immunofluorescence intensity in the alveoli in mice treated

with 1 week and 3 weeks paraquat (

Fig. 4

A and B). Chymase was

colocalized with

␣-SMA but not tryptase in paraquat-treated lung

tissue.

3.2. Paraquat induces angiotensinogen mRNA expression and Ang

II production but does not alter ACE activity and protein

expression in MRC-5 cells

Angiotensinogen mRNA expression increased after paraquat

treatment in a dose-dependent manner, and the values were

Fig. 3. Effects of paraquat treatment on total collagen content in mouse lung.

Paraquat treatment significantly increased total lung collagen content 1 and 3 weeks after administration. Data are presented as the mean± S.D. (n = 4). *p < 0.05 versus control mice at the corresponding time point.

(4)

placebo group (

Fig. 5

A) and chymase siRNA decreased

paraquat-induced Ang II production by 30–80% (

Fig. 5

B). ACE activity and

ACE protein were comparable among various concentrations of

paraquat (

Fig. 5

C and D). Furthermore, ACE activities in the culture

supernatant were unchanged in any experimental groups (data not

shown).

expressions in MRC-5 cells

Chymase mRNA expression was significantly increased after

300 and 500

␮M paraquat treatment when compared with the

0-

␮M paraquat-exposed control (

Fig. 6

A). Chymase protein

expres-sion was increased after paraquat treatment in a dose-dependent

Fig. 4. Confocal immunofluorescence photomicrography of the control and paraquat-treated murine lung tissue. (A) One and 3 weeks PBS-treated control mice displayed faint

staining for chymase (green) and the chymase intensity was upregulated in mice treated with 1 week and 3 weeks paraquat. The intensity of tryptase (red) was constitutively expressed in the control and paraquat-treated mice. Immunohistochemical analyses showed that small amount of chymase is colocalized with tryptase in lung tissue. (B) Control mice displayed weak staining for chymase (red) and␣-SMA (green). The intensity of staining for chymase and ␣-SMA were upregulated in mice treated with 1 week and 3 weeks paraquat. Note that chymase was colocalized with␣-SMA but not tryptase in paraquat-treated animals. Original magnifications: 400×. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

(5)

Y.-D. Lang et al. / Toxicology Letters xxx (2009) xxx–xxx 5

Fig. 5. Effects of paraquat alone or plus chymase siRNA on (A) angiotensinogen mRNA expression, (B) angiotensin (Ang) II level, (C) angiotensin-converting enzyme (ACE)

activity, and (D) ACE in MRC-5 cells. MRC-5 cells were treated with the indicated concentrations of paraquat or with chymase siRNA for 48 h. Angiotensinogen mRNA expressions were significantly increased after paraquat treatment. The Ang II level increased after paraquat treatment in a dose-dependent manner and the transfection of chymase siRNA decreased the Ang II level. ACE activity and ACE protein were comparable among various concentrations of paraquat. Data are presented as the mean± S.D. (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001 versus 0␮M paraquat alone or plus scramble siRNA.

manner, and the addition of chymase siRNA completely inhibited

chymase protein expression (

Fig. 6

B).

3.4. cDNA sequence of human lung fibroblast chymase

Matching the sequence with the chymase sequence in human

mast cells (accession no.: M64269) revealed that the chymase cDNA

sequence and deduced amino acid sequence of the human lung

fibroblast were identical to those reported for human mast cell.

3.5. Chymase siRNA and anti-Ang II antibody inhibits

paraquat-induced TGF-

ˇ1 secretion in MRC-5 cells

TGF-

␤1 levels were significantly increased after paraquat

administration, furthermore, chymase siRNA and Ang II

anti-body decreased the TGF-

␤1 levels (

Fig. 7

A and B). The results

implied that the paraquat-induced chymase activity was mediated

via Ang II and TGF-

␤.

3.6. Chymase siRNA reduces collagen type I expression and total

collagen content in MRC-5 cells

The experiments were performed to determine whether the

fibroblast cultures used in this work respond to stimulation with

paraquat by increasing collagen production. The Western blotting

and Sircol Collagen Assay Kit revealed that exposure to paraquat

increased type I collagen protein expression and collagen content

in cultured lung fibroblasts in a dose-dependent fashion (

Fig. 7

C and

D). The concentration-dependent increase in paraquat-stimulated

collagen expression was reduced in cells transfected with chymase

siRNA, compared with cells that were treated with paraquat alone.

Total collagen content induced by paraquat was largely inhibited

by chymase siRNA.

3.7. Chymase siRNA attenuates

˛-SMA protein expression in

MRC-5 cells

Lung fibroblasts stimulated with paraquat exhibited a

dose-dependent increase in

␣-SMA protein expression and the effects

were inhibited by chymase siRNA (

Fig. 8

A). Paraquat treatment

at a dose of 500

␮M increased ␣-SMA immunofluorescence and

chymase siRNA completely inhibited

␣-SMA expression (

Fig. 8

B).

Fig. 6. Effects of paraquat alone or combined with chymase siRNA on (A)

chymase mRNA expression and (B) chymase protein in MRC-5 cells. Chymase mRNA expressions were significantly increased after 300 and 500␮M paraquat treatment. Chymase protein expression increased after paraquat treatment in a dose-dependent manner, and the addition of chymase siRNA completely inhibited chymase protein expression. Data are presented as the mean± S.D. (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001 versus 0␮M paraquat.

(6)

Fig. 7. Effects of paraquat alone or combined with either chymase siRNA or anti-Ang II antibody on (A and B) TGF-␤1 levels, (C) type I collagen protein expression, and (D) collagen content in MRC-5 cells. TGF-␤1 levels were measured in conditioned media using an ELISA kit. Conditioned medium was collected for measurement of collagen protein by a Sircol Collagen Assay Kit. TGF-␤1 levels, type I collagen protein expression, and collagen content increased after paraquat treatment in a dose-dependent fashion. The concentration-dependent increase was reduced by chymase siRNA or anti-Ang II antibody (5␮g/ml). Data are presented as the mean ± S.D. (n = 3). *p < 0.05, **p < 0.01 and ***p < 0.001 versus 0␮M paraquat alone or plus chymase siRNA, anti-Ang II antibody.

4. Discussion

Paraquat may cause acute respiratory distress syndrome and

the final clinical course is characterized by collagen deposition

and pulmonary fibrosis that lead to reduced expansibility and

vital capacity, and eventually impaired gas exchange. Death

usu-ally occurs due to respiratory failure (

Dinis-Oliveira et al., 2008

).

Survivors of paraquat poisoning may be left with a

restric-tive type of long-term pulmonary dysfunction (

Yamashita et

al., 2000

). The mechanism that leads to pulmonary fibrosis is

not clear. This study clearly showed the existence of an

ACE-independent pathway for Ang II generation, which is sensitive

to chymase siRNA. This evidence supports a functional role for

chymase in the pathogenesis of paraquat-induced lung

fibro-sis.

Collagen is the major extracellular matrix component of the

lungs and is vital for maintaining the normal lung architecture.

Type I collagen is the most abundant collagen subtype in the normal

human lungs (

Kirk et al., 1984

). They are present in the adventitia

of pulmonary arteries, the interstitium of the bronchial tree, the

interlobular septa, the bronchial lamina propria, and the alveolar

interstitium. Although acute lung injury presents as three

consec-utive phases: exudative, proliferative, and fibrotic, recent evidence

suggests that there is an overlap of the inflammatory and

fibropro-liferative phases (

Marshall et al., 2000

). The amounts of collagen

type I (

Liebler et al., 1998

) and III (

Meduri et al., 1998

) and the

numbers of collagen fibers (

Rocco et al., 2001

) increase early in

the course of lung injury and influence the respiratory mechanics.

In this study, we found that collagen increased 1 week and 48 h

after paraquat treatment in murine lung and human lung

fibrob-lasts, respectively. Those findings and our results suggest that the

proliferative phase begins early in the evolution of the lesions. The

effect of paraquat on collagen expression in this study was different

to that of

Darr et al. (1993)

, who found paraquat inhibits

colla-gen expression in human skin fibroblasts. The discrepancy may

be due to the fibroblast from different sources as animal studies

showed that paraquat stimulates lung fibrosis (

Ruiz et al., 2003;

Mohammadi-Karakani et al., 2006

).

Chymase is a chymotrypsin-like serine protease, stored in a

macromolecular complex with heparin proteoglycan within the

secretory granules of mast cells. An ACE-independent pathway for

the conversion of Ang I to Ang II was demonstrated in hamster

cheek pouch blood vessels (

Cornish et al., 1979

). This pathway,

which is an alternate to the ACE pathway, has been demonstrated

in the heart and blood vessels of several species (

Matsumoto et

al., 2003

). A mast cell chymase was identified as the major Ang

II-forming pathway in the human heart (

Urata et al., 1990

). Our

study also provides evidence that cultured MRC-5 cells

synthe-size human chymase. First, a Western Blotting analysis performed

on cell lysates from MRC-5 cells yielded a single band with the

predicted size for human chymase; second, the cDNA sequence

of chymase in MRC-5 cells is identical to that in human mast

cells. The release of human chymase into the MRC-5-conditioned

media was predictable because molecular cloning and

sequenc-ing of cDNA for this enzyme revealed a message encodsequenc-ing a serine

protease with a secretory protein leader peptide. In this study,

chy-mase protein and the collagen content significantly increased in

paraquat-treated human lung fibroblasts, whereas the addition of

a chymase inhibitor, chymase siRNA significantly decreased the

col-lagen content. Therefore, chymase inhibitors may be promising for

treatment of paraquat-induced pulmonary fibrosis.

ACE is distributed along the luminal pulmonary endothelial

sur-face and hydrolyzes Ang I to Ang II. In this study, we found that ACE

expression and activity do not change following paraquat exposure;

angiotensinogen mRNA expression is significantly increased after

paraquat treatment in a dose-dependent manner. These findings

suggest that the increase of Ang II generation in human lung

fibrob-lasts by paraquat is primarily due to an increase in angiotensinogen,

serving as more substrate for Ang II, rather than increased

conver-sion of Ang I to Ang II by ACE. In this study, we found that chymase

inhibitor treatment partially reduced Ang II levels in

paraquat-exposed human lung fibroblasts. These results suggest that other

(7)

Y.-D. Lang et al. / Toxicology Letters xxx (2009) xxx–xxx 7

Fig. 8. Effects of paraquat alone or combined with chymase siRNA on (A) ␣-SMA protein expression and (B) confocal images of␣-SMA. Paraquat treatment significantly increased␣-SMA expression and the effects were inhibited by the addi-tion of chymase siRNA. Paraquat treatment at a dose of 500␮M increases ␣-SMA immunofluorescence and chymase siRNA completely inhibits␣-SMA expression. *p < 0.05, **p < 0.01, and ***p < 0.001 versus 0␮M paraquat. Original magnifications: 400×.

non-ACE pathways such as cathepsins might engage in the

produc-tion of Ang II in paraquat-intoxicated lung fibroblasts (

Kumar and

Boim, 2009

).

TGF-

␤1 is identified as the most important profibrotic cytokine

(

Pulichino et al., 2008

). In this study, we found that paraquat

treat-ment significantly increased TGF-

␤1 levels in a dose-dependent

fashion and the concentration-dependent increase was reduced

by the addition of chymase siRNA or Ang II antibody. The results

indicate that paraquat increases TGF-

␤1 levels via activation of

chymase and Ang II in human lung fibroblasts.

Pulmonary fibrosis is the final result of paraquat-induced lung

injury and is characterized by fibroblast proliferation and

differ-entiation to myofibroblasts that are responsible for production of

extracellular matrix (

Yamashita et al., 2000; Pardo and Selman,

2002

). Myofibroblast are the predominant source of type I

colla-gen and have a phenotype intermediate between fibroblasts and

smooth muscle cells and have been defined by the presence of

␣-SMA (

Zhang et al., 1994; Tomasek et al., 2002

). In this study,

we found elevated type I collagen and

␣-SMA expressions

follow-ing paraquat treatment which are consistent with myofibroblast

phenotype. These findings parallel those in the myofibroblast

formation studies and link the expression of the myofibroblast

phenotype with elevation of collagen synthesis. Mast cell chymase

plays an important role in bleomycin-induced pulmonary fibrosis

in mice (

Tomimori et al., 2003

). In this study, we found that most

chymase is colocalized with

␣-SMA and a small amount of chymase

is colocalized with tryptase. These results indicate that chymase is

secreted from human lung fibroblasts instead of mast cells.

In conclusion, the demonstration of an alternative pathway to

ACE for Ang II generation and the fact that paraquat-treated human

lung fibroblasts are capable of producing and secreting chymase

represent strong evidence of a physiological role for chymase in

paraquat-induced lung fibrosis. With an understanding of these

sig-nal transduction pathways, we can design therapeutic strategies to

reduce fibrosis caused by paraquat intoxication.

Conflict of interest statement

The authors state that they have no financial interest in the

products mentioned within this article.

Acknowledgement

This work was supported by a grant from Taipei Medical

Uni-versity Hospital (98TMU-TMUH-08).

References

Cairns, J.A., Walls, A.F., 1997. Mast cell tryptase stimulates the synthesis of type I collagen in human lung fibroblasts. J. Clin. Invest. 99, 1313–1321.

Cornish, K.G., Joyner, W.L., Gilmore, J.P., 1979. Direct evidence for the presence of a different converting enzyme in the hamster cheek pouch. Circ. Res. 44, 540–544. Darr, D., Combs, S., Murad, S., Pinnell, S., 1993. Studies on the inhibition of colla-gen synthesis in fibroblasts treated with paraquat. Arch. Biochem. Biophys. 306, 267–271.

Dinis-Oliveira, R.J., Duarte, J.A., Sánchez-Navarro, A., Remião, F., Bastos, M.L., Car-valho, F., 2008. Paraquat poisonings: mechanisms of lung toxicity, clinical features, and treatment. Crit. Rev. Toxicol. 38, 13–71.

Kirk, J.M., Heard, B.E., Kerr, I., Turner-Warwick, M., Laurent, G.J., 1984. Quantitation of types I and III collagen in biopsy lung samples from patients with cryptogenic fibrosing alveolitis. Collagen Rel. Res. 4, 169–182.

Kumar, R., Boim, M.A., 2009. Diversity of pathways for intracellular angiotensin II synthesis. Curr. Opin. Nephrol. Hypertens. 18, 33–39.

Liebler, J.M., Qu, Z., Buckner, B., Powers, M.R., Rosenbaum, J.T., 1998. Fibroprolif-eration and mast cells in the acute respiratory distress syndrome. Thorax 53, 823–829.

Marshall, R.P., Bellingan, G., Webb, S., Puddicombe, A., Goldsack, N., McAnulty, R.J., Laurent, G.J., 2000. Fibroproliferation occurs early in the acute respiratory dis-tress syndrome and impacts on outcome. Am. J. Respir. Crit. Care Med. 162, 1783–1788.

Marshall, R.P., Gohlke, P., Chambers, R.C., Howell, D.C., Bottoms, S.E., Unger, T., McAn-ulty, R.J., Laurent, G.J., 2004. Angiotensin II and the fibroproliferative response to acute lung injury. Am. J. Physiol. 286, L156–L164.

Matsumoto, T., Wada, A., Tsutamoto, T., Ohnishi, M., Isono, T., Kinoshita, M., 2003. Chymase inhibition prevents cardiac fibrosis and improves diastolic dysfunction in the progression of heart failure. Circulation 107, 2555–2558.

Meduri, G.U., Tolley, E.A., Chinn, A., Stentz, F., Postlethwaite, A., 1998. Procollagen types I and III aminoterminal propeptide levels during acute respiratory distress syndrome and in response to methylprednisolone treatment. Am. J. Respir. Crit. Care Med. 158, 1432–1441.

Mohammadi-Karakani, A., Ghazi-Khansari, M., Sotoudeh, M., 2006. Lisinopril ame-liorates paraquat-induced lung fibrosis. Clin. Chim. Acta 367, 170–174. Orito, K., Suzuki, Y., Matsuda, H., Shirai, M., Akahori, F., 2004. Chymase is activated

in the pulmonary inflammation and fibrosis induced by paraquat in hamsters. Tohoku J. Exp. Med. 203, 287–294.

Pardo, A., Selman, M., 2002. Molecular mechanisms of pulmonary fibrosis. Front. Biosci. 7, 1743–1761.

Pulichino, A.M., Wang, I.M., Caron, A., Mortimer, J., Auger, A., Boie, Y., Elias, J.A., Kartono, A., Xu, L., Menetski, J., Sayegh, C.E., 2008. Identification of transforming growth factor beta1-driven genetic programs of acute lung fibrosis. Am. J. Respir. Cell Mol. Biol. 39, 324–336.

Reid, A.C., Silver, R.B., Levi, R., 2007. Renin: at the heart of the mast cell. Immunol. Rev. 217, 123–140.

Rocco, P.R.M., Negri, E.M., Kurtz, P.M., Vasconcellos, F.P., Silva, G.H., Capelozzi, V.L., Romero, P.V., Zin, W.A., 2001. Lung tissue mechanics and extracellular matrix in acute lung injury. Am. J. Respir. Crit. Care Med. 164, 1067–1071.

Ruiz, V., Ordó ˜nez, R.M., Berumen, J., Ramírez, R., Uhal, B., Becerril, C., Pardo, A., Selman, M., 2003. Unbalanced collagenases/TIMP-1 expression and epithelial apoptosis in experimental lung fibrosis. Am. J. Physiol. 285, L1026–L1036. Sakaguchi, M., Takai, S., Jin, D., Okamoto, Y., Muramatsu, M., Kim, S., Miyazaki, M.,

2004. A specific chymase inhibitor, NK3201, suppresses bleomycin-induced pul-monary fibrosis in hamsters. Eur. J. Pharmacol. 493, 173–176.

Satoh, T., Hosokawa, M., 2000. Organophosphates and their impact on the global environment. Neurotoxicology 21, 223–227.

Tomasek, J.J., Gabbiani, G., Hinz, B., Chaponnier, C., Brown, R.A., 2002. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat. Rev. Mol. Cell Biol. 3, 349–363.

Tomimori, Y., Muto, T., Saito, K., Tanaka, T., Maruoka, H., Sumida, M., Fukami, H., Fukuda, Y., 2003. Involvement of mast cell chymase in bleomycin-induced pul-monary fibrosis in mice. Eur. J. Pharmacol. 478, 179–185.

Urata, H., Kinoshita, A., Misono, K.S., Bumpus, F.M., Husain, A., 1990. Identification of a highly specific chymase as the major angiotensin II-forming enzyme in human heart. J. Biol. Chem. 265, 22348–22357.

Yamashita, M., Yamashita, M., Ando, Y., 2000. A long-term follow-up of lung function in survivors of paraquat poisoning. Hum. Exp. Toxicol. 19, 99–103.

Zhang, K., Rekhter, M.D., Gordon, D., Phan, S.H., 1994. Co-expression of␣-smooth muscle actin and type I collagen in fibroblast-like cells of rat lungs with bleomycin-induced pulmonary fibrosis: a combined immuno-histochemical and in situ hybridization study. Am. J. Pathol. 145, 114–125.

ScienceDirect w w w . e l s e v i e r . c o m / l o c a t e / t o x l e t (http://www.ncbi.nlm.nih.gov/BLAST

Referanslar

Benzer Belgeler

Bu araştırmanın temel amacı öğrencilerin performans görevlerini gerçekleştirirken bilişim etik kurallarına uyma durumlarını incelemek; bu durumların cinsiyet,

雙和醫療團隊以胃袖狀切除手術,幫助病人減重 27 公斤並擺脫睡眠呼吸中止症 肥胖可不只影響外觀,還會造成睡眠障礙,影響健康。125

Our in vivo model showed that mechanical ventilation at a high tidal volume increased total protein and MIP-2 in the BALF and increased the lung injury score and the number of

To investigate the mechanism of apoptosis induced by nucleosides, it was found that the contents of soluble Fas ligand contents were increased in HepG2 cells following I, U, T, and

Denbinobin-induced cell apoptosis was attenuated by an ASK1 dominant-negative mutant (ASK1DN), two antioxidants (N-acetyl-L-cysteine (NAC) and glutathione (GSH)), a c-Jun

As a result of analyses, pyruvic acid, glyceric acid, adenosine, nonanoic acid and monomethylphosphate were significantly increased while dehydroascorbic acid,

This increasing trends in live cell count, mitochondrial function and protein content are comparable to our other study on A549 cells exposed to 0.5% and 0.25% serum (Nakhjavan,

In view of the great therapeutic interest in propolis and the small number of studies regarding its mechanism of action, the aim of the present study was to evaluate the