Toxicology Letters xxx (2009) xxx–xxx
Contents lists available at
ScienceDirect
Toxicology Letters
j o u r n a l h o m e p a g e :
w w w . e l s e v i e r . c o m / l o c a t e / t o x l e t
Chymase mediates paraquat-induced collagen production in human
lung fibroblasts
Yaw-Dong Lang
a
, Shwu-Fen Chang
a
, Leng-Fang Wang
b
,
1
, Chung-Ming Chen
c
,
∗
,
1
aGraduate Institute of Medical Sciences, Taipei Medical University, Taipei 110, TaiwanbDepartment of Biochemistry, Taipei Medical University, Taipei 110, Taiwan cDepartment of Pediatrics, Taipei Medical University Hospital, Taipei 110, Taiwan
a r t i c l e i n f o
Article history:Received 23 July 2009
Received in revised form 8 October 2009 Accepted 2 December 2009 Available online xxx Keywords: Angiotensin Angiotensin-converting enzyme siRNA
a b s t r a c t
Survivors of paraquat poisoning may be left with pulmonary fibrosis and a restrictive type of pulmonary dysfunction. Chymase converts angiotensin (Ang) I to Ang II, which is closely involved with lung fibrosis. The role played by chymase in paraquat-induced lung fibrosis is unclear. We examined the effects of paraquat on chymase, renin–angiotensin system components, and collagen expression in murine and human lung fibroblasts (MRC-5). Lung chymase and collagen type I mRNA and protein expression were significantly increased and angiotensin-converting enzyme (ACE) mRNA and protein expression were comparable between the control and paraquat-treated mice 1 and 3 weeks after administration. Paraquat significantly upregulated angiotensinogen mRNA expression in a dose-dependent manner while ACE activity and protein expression were similar in MRC-5 cells. Furthermore, paraquat enhanced Ang II and collagen type I mRNA and protein expression,␣-smooth muscle actin, and chymase protein and chymase small interfering RNA inhibited these effects. The cDNA sequence of chymase in MRC-5 cells is identical to that in human mast cells. This study found increased chymase expression in paraquat-treated human lung fibroblasts and confirmed in vitro and in an in vivo paraquat model of lung fibrosis that chymase generates Ang II and enhances collagen expression. These data suggest a role for chymase in the pathogenesis of paraquat-induced lung fibrosis.
© 2009 Elsevier Ireland Ltd. All rights reserved.
1. Introduction
Paraquat dichloride (1,1
-dimethyl-4,4
-bipyridilium
dichlo-ride) is an effective and widely used herbicide. The intentional
and accidental ingestion of commercial liquid formulations of
paraquat has caused a large number of human fatalities. According
to epidemiological data in the National Poison Center in
Tai-wan during 1985 and 1997, paraquat poisoning was the leading
cause of poisoning-induced death in Taiwan (
Satoh and Hosokawa,
2000
). The lungs are one of the primary target organs in
paraquat-produced toxicity in humans (
Dinis-Oliveira et al., 2008
). The acute
toxic effects of paraquat are pulmonary edema, hypoxia, and
res-piratory failure. Survivors of paraquat poisoning may be left with
pulmonary fibrosis that results in a restrictive type of long-term
pulmonary dysfunction (
Yamashita et al., 2000
).
Chymase is a chymotrypsin-like serine protease that is stored
in secretory granules of mast cells. One of the major functions of
chymase is to convert angiotensin (Ang) I to Ang II, which is believed
∗ Corresponding author. Tel.: +886 2 27372181; fax: +886 2 27360399. E-mail address:cmchen@tmu.edu.tw(C.-M. Chen).
1L.F. Wang and C.M. Chen contributed equally to this work.
to play an important role in the pathogenesis of lung fibrosis (
Urata
et al., 1990; Tomimori et al., 2003; Marshall et al., 2004; Orito et al.,
2004; Sakaguchi et al., 2004
). It is well known that mast cells store
and release chymase which catalyzes the transformation of Ang I
into Ang II, and then Ang II stimulates fibroblast proliferation (
Reid
et al., 2007
). However, it is not known whether chymase is produced
by lung fibroblasts and the mechanisms by which paraquat induces
lung fibrosis. The aims of this study were to investigate the effects of
paraquat on lung chymase, angiotensin-converting enzyme (ACE),
and collagen expression in mice and to evaluate the role of chymase
in paraquat-induced lung fibrosis by measuring renin–angiotensin
system components and collagen in human lung fibroblasts.
2. Materials and methods
2.1. Animals
A total of 27 male C57BL/6 mice (8–10-week old) were purchased from Bio-LASCO Technology (Charles River Taiwan Ltd). All mice received standard animal care under the supervision of Institutional Animal Care and Use Committee at Taipei Medical University. The mice were caged in an air-conditioned animal facility with food and water available ad libitum in a room maintained under constant temper-ature and humidity conditions with a 12:12 light–dark cycle. The mice were given intraperitoneally (i.p.) paraquat 20 mg/kg or an equivalent volume of sterile-filtered phosphate-buffered saline (PBS). One and 3 weeks after paraquat treatment, mice 0378-4274/$ – see front matter © 2009 Elsevier Ireland Ltd. All rights reserved.
Primers used for real-time PCR in mice.
Primer Sequence 5→ 3 Accession no.
ACE 479CAGAATCTACTCCACTGGCAAGGT502 NM207624 576TTCGTGAGGAAGCCAGGATGT556 Chymase 183AGCTGGAGAGATCATTGGAG202 NM010780 282GCAGGCCGACAGGTAGTTCT263 Collagen I 232AAACCCGAGGTATGCTTGATCTGTA256 NM007742 406GTCCCTCGACTCCTACATCTTCTGA382 GADPH 97GAATGGGAAGCTTGTCATCAACGG120 XM983502 204GTAGACTCCACGACATACTCAGCAC180
were euthanized i.p. with 50 mg/kg pentobarbital and decapitated. Six mice were used for control group and 8 and 7 mice were used for 1 and 3 weeks paraquat-treated groups, respectively. All mice survived in the control and paraquat-paraquat-treated groups.Cell culture
MRC-5 cells (human lung fibroblasts; ATCC, Manassas, VA, USA) were main-tained in Dulbecco’s minimal essential medium (DMEM, Gibco, Grand Island, NY, USA) supplemented with 100 U/ml penicillin, 100g/mL streptomycin, and 10% heat-inactivated fetal calf serum (FCS; Gibco), and incubated at 37◦C in 5%
CO2. Fibroblasts between passages 25 and 35 were used for all experiments. For
collagen expression induced by paraquat, 50g/mL ascorbic acid and 50 g/mL -aminopropionitrile fumarate (Sigma–Aldrich, Saint Louis, MO, USA) were added to the culture medium. Cells were grown to confluence and then serum-starved in DMEM containing 0.2% FCS for 24 h before stimulation with drugs. The cytotoxic effects of paraquat on incubated MRC-5 cells were measured using the 3-(4,5-methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay over a range of doses (100–900M) for 48 h. The cell viability was maintained at ∼90% below 500M paraquat, but decreased significantly above 700 M paraquat. Therefore, paraquat concentrations between 0 and 500M were used in this study. 2.3. Real-time PCR
The abundance of mRNA was determined by reverse transcription, followed by real-time PCR using appropriate primers (Tables 1 and 2). Total RNA was extracted using TRIzol Reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) and treated with RNAase-free DNAase (Sigma–Aldrich). Two microgram of total RNA and oligo (dT) were used to synthesize cDNAs with a First-Strand cDNA Synthesis Kit (GE Healthcare, Piscataway, NJ, USA). Gene expression was quantified by SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and carried out using the ABI Prism 7300 Sequence Detection System. The relative quantitation of gene expression was normalized to GAPDH or 18S rRNA as internal standard. Triplicate experiments were done for each sample.Collagen assay
Total soluble collagen was measured in murine lung tissue and cultured super-natant using the Sircol Collagen Assay Kit (Biocolor, Belfast, UK). Briefly, 0.3 ml of Sirius dye reagent was added to an equal volume of test sample and mixed for 30 min at room temperature. The collagen-dye complex was precipitated by centrifugation and dissolved in 0.5 M sodium hydroxide; the absorbance was measured at 540 nm. The collagen level in each specimen was obtained as an average of three readings. 2.5. Western blotting analysis
Proteins were separated on 12% SDS-polyacrylamide gel, and electrophoretically transferred onto polyvinylidene fluoride membrane. The primary antibodies used in this study were mouse anti-ACE (1:100; Santa Cruz Biotechnology, Santa Cruz, CA, USA), mouse chymase (1:1,000; Abcam, Cambridge, MA, USA), mouse anti-␣-smooth muscle actin (␣-SMA) (1:10,000; Sigma–Aldrich), rabbit anti-collagen type I (1:2,500; Abcam) and mouse anti--actin (1:100,000; Sigma–Aldrich). After incubation with the primary antibody, the membranes were probed with the appropriate horseradish peroxidase-conjugated secondary antibody (anti-mouse or anti-rabbit, 1:20,000; Pierce, Rockford, IL, USA). Immune complexes were visu-alized using ECL plus detection reagents (Pierce). Quantitative comparison of the fluorescent images was achieved with a densitometer. Densitometric analysis was performed to measure the intensity of all Western Blotting bands using AIDA
soft-Table 2
Primers used for real-time PCR in MRC-5 cell culture.
Primer Sequence 5→ 3 Accession no.
Angiotensinogen 237CACCTCGTCATCCACAATGAGA258 NM000029 343GATGTCTTGGCCTGAATTGG324 Chymase 666GGCCCAGGGCATCGTATC684 NM001836 782CAGGATTAATTTGCCTGCAGG4481 Collagen I 1303GTGCTAAAGGTGCCAATGGT1322 NM000088 1430ACCAGGTTCACCGCTGTTAC1411
18S rRNA 70GGACACGGACAGGATTGACA89 AJ844646 119ACCCACGGAATCGAGAAAGA100
Germany). 2.6. Angiotensin II
The quantitative measurement of Ang II in culture supernatant was measured by an ELISA kit (Phoenix Pharmaceuticals, Burlingame, CA, USA). Briefly, the stan-dards or samples were incubated with anti-Ang II antibody and biotinylated Ang II. After incubation, the bound biotinylated Ang II was determined by means of its reaction with streptavidin–horseradish peroxidase using tetramethyl benzidine dihydrochloride and hydrogen peroxide as a substrate. The reaction was termi-nated with 2N HCl, and the color intensity was measured at 450 nm using an ELISA microtiter plate reader.
2.7. ACE activity
ACE activity was measured using a commercially available kit according to the manufacturer’s instructions (Bühlmann Laboratories, Schönenbuch, Switzerland). Briefly, cell lysates were incubated with N-hippuryl-l-histidyl-l-leucine as sub-strate, and the released hippuric acid was then complexed with cyanuric chloride, and this complex was measured at 382 nm. Samples were measured in triplicate and quantitated by comparison to standards.Immunofluorescence and confocal microscopy
Samples were fixed in 4% para-formaldehyde and blocked with bovine serum albumin. Samples were then incubated with proper primary antibodies (mouse anti-chymase, mouse anti-␣-SMA, or rabbit anti-tryptase (1:100, Santa Cruz Biotechnology) for 16 h. Indirect immunolabeling was performed by incubation with an FITC-conjugated anti-mouse IgG antibody (1:400, Zymed, San Francisco, CA, USA) and a Cy3-conjugated rabbit IgG antibody (1:200, Zymed) as the secondary anti-bodies for 1 h. 4,6-Diamidino-2-phenylindole (DAPI, Sigma–Aldrich) was used for nuclear staining. Images of marked cells were captured with a confocal microscope (Leica Microsystems, Exton, PA, USA).
2.9. Generation and transfection of small interfering RNA (siRNA)
The two pairs of primers for the amplification of the chymase siRNA were as follows: sense: 5-CATGGCCTACCTGGAAATTG-3 and antisense: 5 -TCAAGCTTCTGCCATGTGTC-3; and sense: 5-TGCAAGAGGTGAAGCTGAGA-3, and antisense: 5-GTAATGGGAGATTCGGGTGA-3. Purified PCR products were
tran-scribed using the X-tremeGENE siRNA Dicer Kit (Roche Applied Science,
Fig. 1. Effects of paraquat treatment on (A) chymase, (B) angiotensin-converting enzyme (ACE), and (C) type I collagen mRNA expressions in mouse lung. Chymase and type I collagen mRNA expressions were significantly increased while ACE mRNA expressions were comparable between the control and paraquat-treated mice 1 and 3 weeks after paraquat treatment. Data are presented as the mean± S.D. (n = 5). *p < 0.05 versus control mice at the corresponding time point.
Y.-D. Lang et al. / Toxicology Letters xxx (2009) xxx–xxx 3 Indianapolis, IN, USA). The resulting double-stranded RNA was digested with
bac-terial RNase III (Roche Applied Science). MRC-5 cells were seeded into 6-well plates and cultured with 40% DMEM and 40% opti-MEM (Invitrogen Life Technologies) supplemented with 10% FBS without antibiotics 2 days before transfection. When 50% confluence was reached, the chymase and Silencer®negative control (scramble) siRNA (Ambion Inc., Austin, TX, USA) were transfected with Lipofectamine RNAiMAX (Invitrogen Life Technologies) 24 h before the administration of paraquat. 2.10. cDNA sequencing
Human lung fibroblast chymase cDNA was obtained by RT-PCR amplifi-cation of total RNA. Reverse transcription of each RNA sample was carried out using a First-Strand cDNA Synthesis Kit (GE Healthcare). The chymase primers (sense 5-GGCAGCCTCTCTGGGAAG ATGCTGCTTCTTC-3 and antisense
Fig. 2. Effects of paraquat treatment on (A) chymase, (B) angiotensin-converting
enzyme (ACE), and (C) type I collagen protein expressions in mouse lung. Chymase and type I collagen protein were significantly increased while ACE were comparable between the control and paraquat-treated mice 1 and 3 weeks after paraquat treat-ment. Data are presented as the mean± S.D. (n = 4). *p < 0.05 and **p < 0.01 versus control mice at the corresponding time point.
5-ATTTGCCTGCAGGATCTGGTTGATCCAGGGC-3) were designed based on NCBI accession no.: M64269. The amplification profile generated a 769-base pair full-length chymase cDNA. The PCR products were purified by QIAquick PCR Purification Kit (Qiagen, Valencia, CA, USA) and analysed using an ABI 3730 automated DNA sequencer (Applied Biosystems). The human lung fibroblast sequencing results were then matched with those from the sequencing of the human mast cell chymase sequencing (accession no.: M64269) by the NCBI Basic Local Alignment Search Tool (BLAST) (http://www.ncbi.nlm.nih.gov/BLAST).
2.11. Transforming growth factor-ˇ1 (TGF-ˇ1) assay
Active TGF-1 levels were measured in conditioned media using an ELISA kit (R&D, Minneapolis, MN, USA) according to the manufacturer’s instructions and samples were measured in triplicate and quantitated by comparison to standards. To study the role of Ang II pathway in paraquat-induced collagen production, MRC-5 cells were treated with anti-Ang II antibody (5g/ml, Phoenix Pharma-ceuticals, Burlingame, CA, USA) for 48 h to analyze its effect on active TGF-1 levels.
2.12. Statistical analysis
Data are expressed as the mean± S.D. Comparisons between control and paraquatreated mice at each time point were made using unpaired Student’s t-test. Analysis of difference among multiple groups in cell cultures was evaluated by one-way ANOVA with post hoc Turkey’s test. A p-value of <0.05 was considered statistically significant.
3. Results
3.1. Paraquat increases chymase,
˛-SMA, and collagen type I
mRNA and protein expression but does not alter ACE mRNA and
protein expression in mouse lung
In this study, we measured only type I collagen expression
because it constitutes greater than 65% of the total lung
colla-gen in normal human lung (
Cairns and Walls, 1997
). Chymase
and type I collagen mRNA and protein expression were
signifi-cantly increased whereas ACE mRNA and protein expression were
comparable between the control and paraquat-treated murine
lung 1 and 3 weeks after paraquat treatment (
Figs. 1 and 2
).
Paraquat treatment significantly increased total lung collagen
con-tents 1 and 3 weeks after administration when compared with
the control group (
Fig. 3
). Control mice displayed faint staining
for chymase and paraquat treatment increased chymase and
␣-SMA immunofluorescence intensity in the alveoli in mice treated
with 1 week and 3 weeks paraquat (
Fig. 4
A and B). Chymase was
colocalized with
␣-SMA but not tryptase in paraquat-treated lung
tissue.
3.2. Paraquat induces angiotensinogen mRNA expression and Ang
II production but does not alter ACE activity and protein
expression in MRC-5 cells
Angiotensinogen mRNA expression increased after paraquat
treatment in a dose-dependent manner, and the values were
Fig. 3. Effects of paraquat treatment on total collagen content in mouse lung.
Paraquat treatment significantly increased total lung collagen content 1 and 3 weeks after administration. Data are presented as the mean± S.D. (n = 4). *p < 0.05 versus control mice at the corresponding time point.
placebo group (
Fig. 5
A) and chymase siRNA decreased
paraquat-induced Ang II production by 30–80% (
Fig. 5
B). ACE activity and
ACE protein were comparable among various concentrations of
paraquat (
Fig. 5
C and D). Furthermore, ACE activities in the culture
supernatant were unchanged in any experimental groups (data not
shown).
expressions in MRC-5 cells
Chymase mRNA expression was significantly increased after
300 and 500
M paraquat treatment when compared with the
0-
M paraquat-exposed control (
Fig. 6
A). Chymase protein
expres-sion was increased after paraquat treatment in a dose-dependent
Fig. 4. Confocal immunofluorescence photomicrography of the control and paraquat-treated murine lung tissue. (A) One and 3 weeks PBS-treated control mice displayed faint
staining for chymase (green) and the chymase intensity was upregulated in mice treated with 1 week and 3 weeks paraquat. The intensity of tryptase (red) was constitutively expressed in the control and paraquat-treated mice. Immunohistochemical analyses showed that small amount of chymase is colocalized with tryptase in lung tissue. (B) Control mice displayed weak staining for chymase (red) and␣-SMA (green). The intensity of staining for chymase and ␣-SMA were upregulated in mice treated with 1 week and 3 weeks paraquat. Note that chymase was colocalized with␣-SMA but not tryptase in paraquat-treated animals. Original magnifications: 400×. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
Y.-D. Lang et al. / Toxicology Letters xxx (2009) xxx–xxx 5
Fig. 5. Effects of paraquat alone or plus chymase siRNA on (A) angiotensinogen mRNA expression, (B) angiotensin (Ang) II level, (C) angiotensin-converting enzyme (ACE)
activity, and (D) ACE in MRC-5 cells. MRC-5 cells were treated with the indicated concentrations of paraquat or with chymase siRNA for 48 h. Angiotensinogen mRNA expressions were significantly increased after paraquat treatment. The Ang II level increased after paraquat treatment in a dose-dependent manner and the transfection of chymase siRNA decreased the Ang II level. ACE activity and ACE protein were comparable among various concentrations of paraquat. Data are presented as the mean± S.D. (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001 versus 0M paraquat alone or plus scramble siRNA.
manner, and the addition of chymase siRNA completely inhibited
chymase protein expression (
Fig. 6
B).
3.4. cDNA sequence of human lung fibroblast chymase
Matching the sequence with the chymase sequence in human
mast cells (accession no.: M64269) revealed that the chymase cDNA
sequence and deduced amino acid sequence of the human lung
fibroblast were identical to those reported for human mast cell.
3.5. Chymase siRNA and anti-Ang II antibody inhibits
paraquat-induced TGF-
ˇ1 secretion in MRC-5 cells
TGF-
1 levels were significantly increased after paraquat
administration, furthermore, chymase siRNA and Ang II
anti-body decreased the TGF-
1 levels (
Fig. 7
A and B). The results
implied that the paraquat-induced chymase activity was mediated
via Ang II and TGF-
.
3.6. Chymase siRNA reduces collagen type I expression and total
collagen content in MRC-5 cells
The experiments were performed to determine whether the
fibroblast cultures used in this work respond to stimulation with
paraquat by increasing collagen production. The Western blotting
and Sircol Collagen Assay Kit revealed that exposure to paraquat
increased type I collagen protein expression and collagen content
in cultured lung fibroblasts in a dose-dependent fashion (
Fig. 7
C and
D). The concentration-dependent increase in paraquat-stimulated
collagen expression was reduced in cells transfected with chymase
siRNA, compared with cells that were treated with paraquat alone.
Total collagen content induced by paraquat was largely inhibited
by chymase siRNA.
3.7. Chymase siRNA attenuates
˛-SMA protein expression in
MRC-5 cells
Lung fibroblasts stimulated with paraquat exhibited a
dose-dependent increase in
␣-SMA protein expression and the effects
were inhibited by chymase siRNA (
Fig. 8
A). Paraquat treatment
at a dose of 500
M increased ␣-SMA immunofluorescence and
chymase siRNA completely inhibited
␣-SMA expression (
Fig. 8
B).
Fig. 6. Effects of paraquat alone or combined with chymase siRNA on (A)
chymase mRNA expression and (B) chymase protein in MRC-5 cells. Chymase mRNA expressions were significantly increased after 300 and 500M paraquat treatment. Chymase protein expression increased after paraquat treatment in a dose-dependent manner, and the addition of chymase siRNA completely inhibited chymase protein expression. Data are presented as the mean± S.D. (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001 versus 0M paraquat.
Fig. 7. Effects of paraquat alone or combined with either chymase siRNA or anti-Ang II antibody on (A and B) TGF-1 levels, (C) type I collagen protein expression, and (D) collagen content in MRC-5 cells. TGF-1 levels were measured in conditioned media using an ELISA kit. Conditioned medium was collected for measurement of collagen protein by a Sircol Collagen Assay Kit. TGF-1 levels, type I collagen protein expression, and collagen content increased after paraquat treatment in a dose-dependent fashion. The concentration-dependent increase was reduced by chymase siRNA or anti-Ang II antibody (5g/ml). Data are presented as the mean ± S.D. (n = 3). *p < 0.05, **p < 0.01 and ***p < 0.001 versus 0M paraquat alone or plus chymase siRNA, anti-Ang II antibody.
4. Discussion
Paraquat may cause acute respiratory distress syndrome and
the final clinical course is characterized by collagen deposition
and pulmonary fibrosis that lead to reduced expansibility and
vital capacity, and eventually impaired gas exchange. Death
usu-ally occurs due to respiratory failure (
Dinis-Oliveira et al., 2008
).
Survivors of paraquat poisoning may be left with a
restric-tive type of long-term pulmonary dysfunction (
Yamashita et
al., 2000
). The mechanism that leads to pulmonary fibrosis is
not clear. This study clearly showed the existence of an
ACE-independent pathway for Ang II generation, which is sensitive
to chymase siRNA. This evidence supports a functional role for
chymase in the pathogenesis of paraquat-induced lung
fibro-sis.
Collagen is the major extracellular matrix component of the
lungs and is vital for maintaining the normal lung architecture.
Type I collagen is the most abundant collagen subtype in the normal
human lungs (
Kirk et al., 1984
). They are present in the adventitia
of pulmonary arteries, the interstitium of the bronchial tree, the
interlobular septa, the bronchial lamina propria, and the alveolar
interstitium. Although acute lung injury presents as three
consec-utive phases: exudative, proliferative, and fibrotic, recent evidence
suggests that there is an overlap of the inflammatory and
fibropro-liferative phases (
Marshall et al., 2000
). The amounts of collagen
type I (
Liebler et al., 1998
) and III (
Meduri et al., 1998
) and the
numbers of collagen fibers (
Rocco et al., 2001
) increase early in
the course of lung injury and influence the respiratory mechanics.
In this study, we found that collagen increased 1 week and 48 h
after paraquat treatment in murine lung and human lung
fibrob-lasts, respectively. Those findings and our results suggest that the
proliferative phase begins early in the evolution of the lesions. The
effect of paraquat on collagen expression in this study was different
to that of
Darr et al. (1993)
, who found paraquat inhibits
colla-gen expression in human skin fibroblasts. The discrepancy may
be due to the fibroblast from different sources as animal studies
showed that paraquat stimulates lung fibrosis (
Ruiz et al., 2003;
Mohammadi-Karakani et al., 2006
).
Chymase is a chymotrypsin-like serine protease, stored in a
macromolecular complex with heparin proteoglycan within the
secretory granules of mast cells. An ACE-independent pathway for
the conversion of Ang I to Ang II was demonstrated in hamster
cheek pouch blood vessels (
Cornish et al., 1979
). This pathway,
which is an alternate to the ACE pathway, has been demonstrated
in the heart and blood vessels of several species (
Matsumoto et
al., 2003
). A mast cell chymase was identified as the major Ang
II-forming pathway in the human heart (
Urata et al., 1990
). Our
study also provides evidence that cultured MRC-5 cells
synthe-size human chymase. First, a Western Blotting analysis performed
on cell lysates from MRC-5 cells yielded a single band with the
predicted size for human chymase; second, the cDNA sequence
of chymase in MRC-5 cells is identical to that in human mast
cells. The release of human chymase into the MRC-5-conditioned
media was predictable because molecular cloning and
sequenc-ing of cDNA for this enzyme revealed a message encodsequenc-ing a serine
protease with a secretory protein leader peptide. In this study,
chy-mase protein and the collagen content significantly increased in
paraquat-treated human lung fibroblasts, whereas the addition of
a chymase inhibitor, chymase siRNA significantly decreased the
col-lagen content. Therefore, chymase inhibitors may be promising for
treatment of paraquat-induced pulmonary fibrosis.
ACE is distributed along the luminal pulmonary endothelial
sur-face and hydrolyzes Ang I to Ang II. In this study, we found that ACE
expression and activity do not change following paraquat exposure;
angiotensinogen mRNA expression is significantly increased after
paraquat treatment in a dose-dependent manner. These findings
suggest that the increase of Ang II generation in human lung
fibrob-lasts by paraquat is primarily due to an increase in angiotensinogen,
serving as more substrate for Ang II, rather than increased
conver-sion of Ang I to Ang II by ACE. In this study, we found that chymase
inhibitor treatment partially reduced Ang II levels in
paraquat-exposed human lung fibroblasts. These results suggest that other
Y.-D. Lang et al. / Toxicology Letters xxx (2009) xxx–xxx 7
Fig. 8. Effects of paraquat alone or combined with chymase siRNA on (A) ␣-SMA protein expression and (B) confocal images of␣-SMA. Paraquat treatment significantly increased␣-SMA expression and the effects were inhibited by the addi-tion of chymase siRNA. Paraquat treatment at a dose of 500M increases ␣-SMA immunofluorescence and chymase siRNA completely inhibits␣-SMA expression. *p < 0.05, **p < 0.01, and ***p < 0.001 versus 0M paraquat. Original magnifications: 400×.
non-ACE pathways such as cathepsins might engage in the
produc-tion of Ang II in paraquat-intoxicated lung fibroblasts (
Kumar and
Boim, 2009
).
TGF-
1 is identified as the most important profibrotic cytokine
(
Pulichino et al., 2008
). In this study, we found that paraquat
treat-ment significantly increased TGF-
1 levels in a dose-dependent
fashion and the concentration-dependent increase was reduced
by the addition of chymase siRNA or Ang II antibody. The results
indicate that paraquat increases TGF-
1 levels via activation of
chymase and Ang II in human lung fibroblasts.
Pulmonary fibrosis is the final result of paraquat-induced lung
injury and is characterized by fibroblast proliferation and
differ-entiation to myofibroblasts that are responsible for production of
extracellular matrix (
Yamashita et al., 2000; Pardo and Selman,
2002
). Myofibroblast are the predominant source of type I
colla-gen and have a phenotype intermediate between fibroblasts and
smooth muscle cells and have been defined by the presence of
␣-SMA (
Zhang et al., 1994; Tomasek et al., 2002
). In this study,
we found elevated type I collagen and
␣-SMA expressions
follow-ing paraquat treatment which are consistent with myofibroblast
phenotype. These findings parallel those in the myofibroblast
formation studies and link the expression of the myofibroblast
phenotype with elevation of collagen synthesis. Mast cell chymase
plays an important role in bleomycin-induced pulmonary fibrosis
in mice (
Tomimori et al., 2003
). In this study, we found that most
chymase is colocalized with
␣-SMA and a small amount of chymase
is colocalized with tryptase. These results indicate that chymase is
secreted from human lung fibroblasts instead of mast cells.
In conclusion, the demonstration of an alternative pathway to
ACE for Ang II generation and the fact that paraquat-treated human
lung fibroblasts are capable of producing and secreting chymase
represent strong evidence of a physiological role for chymase in
paraquat-induced lung fibrosis. With an understanding of these
sig-nal transduction pathways, we can design therapeutic strategies to
reduce fibrosis caused by paraquat intoxication.
Conflict of interest statement
The authors state that they have no financial interest in the
products mentioned within this article.
Acknowledgement
This work was supported by a grant from Taipei Medical
Uni-versity Hospital (98TMU-TMUH-08).
References
Cairns, J.A., Walls, A.F., 1997. Mast cell tryptase stimulates the synthesis of type I collagen in human lung fibroblasts. J. Clin. Invest. 99, 1313–1321.
Cornish, K.G., Joyner, W.L., Gilmore, J.P., 1979. Direct evidence for the presence of a different converting enzyme in the hamster cheek pouch. Circ. Res. 44, 540–544. Darr, D., Combs, S., Murad, S., Pinnell, S., 1993. Studies on the inhibition of colla-gen synthesis in fibroblasts treated with paraquat. Arch. Biochem. Biophys. 306, 267–271.
Dinis-Oliveira, R.J., Duarte, J.A., Sánchez-Navarro, A., Remião, F., Bastos, M.L., Car-valho, F., 2008. Paraquat poisonings: mechanisms of lung toxicity, clinical features, and treatment. Crit. Rev. Toxicol. 38, 13–71.
Kirk, J.M., Heard, B.E., Kerr, I., Turner-Warwick, M., Laurent, G.J., 1984. Quantitation of types I and III collagen in biopsy lung samples from patients with cryptogenic fibrosing alveolitis. Collagen Rel. Res. 4, 169–182.
Kumar, R., Boim, M.A., 2009. Diversity of pathways for intracellular angiotensin II synthesis. Curr. Opin. Nephrol. Hypertens. 18, 33–39.
Liebler, J.M., Qu, Z., Buckner, B., Powers, M.R., Rosenbaum, J.T., 1998. Fibroprolif-eration and mast cells in the acute respiratory distress syndrome. Thorax 53, 823–829.
Marshall, R.P., Bellingan, G., Webb, S., Puddicombe, A., Goldsack, N., McAnulty, R.J., Laurent, G.J., 2000. Fibroproliferation occurs early in the acute respiratory dis-tress syndrome and impacts on outcome. Am. J. Respir. Crit. Care Med. 162, 1783–1788.
Marshall, R.P., Gohlke, P., Chambers, R.C., Howell, D.C., Bottoms, S.E., Unger, T., McAn-ulty, R.J., Laurent, G.J., 2004. Angiotensin II and the fibroproliferative response to acute lung injury. Am. J. Physiol. 286, L156–L164.
Matsumoto, T., Wada, A., Tsutamoto, T., Ohnishi, M., Isono, T., Kinoshita, M., 2003. Chymase inhibition prevents cardiac fibrosis and improves diastolic dysfunction in the progression of heart failure. Circulation 107, 2555–2558.
Meduri, G.U., Tolley, E.A., Chinn, A., Stentz, F., Postlethwaite, A., 1998. Procollagen types I and III aminoterminal propeptide levels during acute respiratory distress syndrome and in response to methylprednisolone treatment. Am. J. Respir. Crit. Care Med. 158, 1432–1441.
Mohammadi-Karakani, A., Ghazi-Khansari, M., Sotoudeh, M., 2006. Lisinopril ame-liorates paraquat-induced lung fibrosis. Clin. Chim. Acta 367, 170–174. Orito, K., Suzuki, Y., Matsuda, H., Shirai, M., Akahori, F., 2004. Chymase is activated
in the pulmonary inflammation and fibrosis induced by paraquat in hamsters. Tohoku J. Exp. Med. 203, 287–294.
Pardo, A., Selman, M., 2002. Molecular mechanisms of pulmonary fibrosis. Front. Biosci. 7, 1743–1761.
Pulichino, A.M., Wang, I.M., Caron, A., Mortimer, J., Auger, A., Boie, Y., Elias, J.A., Kartono, A., Xu, L., Menetski, J., Sayegh, C.E., 2008. Identification of transforming growth factor beta1-driven genetic programs of acute lung fibrosis. Am. J. Respir. Cell Mol. Biol. 39, 324–336.
Reid, A.C., Silver, R.B., Levi, R., 2007. Renin: at the heart of the mast cell. Immunol. Rev. 217, 123–140.
Rocco, P.R.M., Negri, E.M., Kurtz, P.M., Vasconcellos, F.P., Silva, G.H., Capelozzi, V.L., Romero, P.V., Zin, W.A., 2001. Lung tissue mechanics and extracellular matrix in acute lung injury. Am. J. Respir. Crit. Care Med. 164, 1067–1071.
Ruiz, V., Ordó ˜nez, R.M., Berumen, J., Ramírez, R., Uhal, B., Becerril, C., Pardo, A., Selman, M., 2003. Unbalanced collagenases/TIMP-1 expression and epithelial apoptosis in experimental lung fibrosis. Am. J. Physiol. 285, L1026–L1036. Sakaguchi, M., Takai, S., Jin, D., Okamoto, Y., Muramatsu, M., Kim, S., Miyazaki, M.,
2004. A specific chymase inhibitor, NK3201, suppresses bleomycin-induced pul-monary fibrosis in hamsters. Eur. J. Pharmacol. 493, 173–176.
Satoh, T., Hosokawa, M., 2000. Organophosphates and their impact on the global environment. Neurotoxicology 21, 223–227.
Tomasek, J.J., Gabbiani, G., Hinz, B., Chaponnier, C., Brown, R.A., 2002. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat. Rev. Mol. Cell Biol. 3, 349–363.
Tomimori, Y., Muto, T., Saito, K., Tanaka, T., Maruoka, H., Sumida, M., Fukami, H., Fukuda, Y., 2003. Involvement of mast cell chymase in bleomycin-induced pul-monary fibrosis in mice. Eur. J. Pharmacol. 478, 179–185.
Urata, H., Kinoshita, A., Misono, K.S., Bumpus, F.M., Husain, A., 1990. Identification of a highly specific chymase as the major angiotensin II-forming enzyme in human heart. J. Biol. Chem. 265, 22348–22357.
Yamashita, M., Yamashita, M., Ando, Y., 2000. A long-term follow-up of lung function in survivors of paraquat poisoning. Hum. Exp. Toxicol. 19, 99–103.
Zhang, K., Rekhter, M.D., Gordon, D., Phan, S.H., 1994. Co-expression of␣-smooth muscle actin and type I collagen in fibroblast-like cells of rat lungs with bleomycin-induced pulmonary fibrosis: a combined immuno-histochemical and in situ hybridization study. Am. J. Pathol. 145, 114–125.
