Effects of glyphosate on juvenile rainbow trout (Oncorhynchus mykiss):
Transcriptional and enzymatic analyses of antioxidant defence system,
histopathological liver damage and swimming performance
Ahmet Topal
a, Muhammed Atamanalp
b, Arzu Uçar
b, Ertan Oruç
c,
Esat Mahmut Kocaman
b, Ekrem Sulukan
b,g, Fatih Akdemir
d,
Şükrü Beydemir
e,
Nam
ık Kılınç
e, Orhan Erdo
ğan
f, Saltuk Bu
ğrahan Ceyhun
b,g,n aDepartment of Basic Sciences, Faculty of Fisheries, Ataturk University, Erzurum, Turkeyb
Department of Aquaculture, Faculty of Fisheries, Atatürk University, Erzurum, Turkey
c
Department of Pathology, Faculty of Veterinary, Atatürk University, Erzurum, Turkey
d
Department of Medical Biology, Faculty of Medicine, Atatürk University, Erzurum, Turkey
e
Department of Chemistry, Faculty of Science, Atatürk University, Erzurum, Turkey
f
Department of Molecular Biology and Genetic, Faculty of Science, Atatürk University, Erzurum, Turkey
gAquatic Biotechnology Laboratory, Faculty of Fisheries, Atatürk University, Erzurum, Turkey
a r t i c l e i n f o
Article history: Received 23 May 2014 Received in revised form 23 September 2014 Accepted 25 September 2014 Available online 29 October 2014 Keywords: Antioxidant enzymes Behaviour Histopathology Gene expression
a b s t r a c t
This study aims to determine the effect of glyphosate on the transcriptional and enzymatic activity of antioxidant metabolism enzymes of juvenile rainbow trout with short term (6, 12, 24, 48 and 96 h) and long term (21 days) exposures followed by a recovery treatment. This study also aims to determine the effects of glyphosate exposure on liver tissue damage and swimming performance due to short term (2.5, 5 and 10 mg/L) and long term (2.5 and 5 mg/L) exposures. Following pesticide administration, tenfish, each as a sample, were caught at 6th, 12th, 24th, 48th and 96th -h for the short term, and at 21st day for the long term exposure study. GPx activity was found to be significantly induced 12 h after the exposure to 2.5 mg/L of glyphosate as compared with the control group. A similar degree of induction was also observed for CAT activity but not for SOD. For long term exposure, except for the GPx activity after exposure to 5 mg/L of glyphosate, the activities of all other enzymes remained on a par with the control group. It was also observed that the levels of gene expression of these enzymes were not comparable with each other. It is assumed that these differences might result from the effect of glyphosate before translation and the possible reasons for this scenario are also discussed. The results of swimming per-formance are found to be consistent with responses of the antioxidant system, and they are attributed to the energy metabolism. The data are also supported with liver histopathology analysis.
& 2014 Elsevier Inc. All rights reserved.
1. Introduction
It is well known that pesticides are may be a chemical sub-stance, biological agent (such as a virus or bacteria), antimicrobial, disinfectant or device used against to pests. Although there are some benefits to the use of pesticides, they may also cause various
side effects, e.g. modify the structure of DNA (Lee and Steinert, 2003), cause sperm malformations (Mathew et al., 1992), generate reactive oxygen species (ROS) (Bagchi et al., 1995), influence an-tioxidant defence system (Barlow et al., 2005) and act as inducers of heat shock protein (Ceyhun et al., 2010) in tissues and cells in different organisms. Glyphosate (N-(phosphonomethyl)glycine) is a broad-spectrum systemic herbicide used to kill weeds, especially annual broad leaf weeds and grasses known to compete with commercial crops grown around the globe. It is commonly used for agriculture, horticulture, viticulture and silviculture purposes, as well as garden maintenance. This chemical is very toxic to most aquatic organisms includingfish (Folmar et al., 1979). Moreover, the use of commercial glyphosate has dramatically increased in recent years (Kreutz et al., 2011). However, little information is
available on toxicity and about swimming performance,
Contents lists available atScienceDirect
journal homepage:www.elsevier.com/locate/ecoenv
Ecotoxicology and Environmental Safety
http://dx.doi.org/10.1016/j.ecoenv.2014.09.027
0147-6513/& 2014 Elsevier Inc. All rights reserved.
nCorresponding author at: Department of Aquaculture, Faculty of Fisheries,
Atatürk University, Erzurum, Turkey.
E-mail addresses:[email protected](A. Topal),
[email protected](M. Atamanalp),[email protected](A. Uçar),
[email protected](E. Oruç),[email protected](E.M. Kocaman),
[email protected](E. Sulukan),[email protected](F. Akdemir),
[email protected](Ş. Beydemir),[email protected](N. Kılınç),
histopathological and biochemical effects infish of glyphosate as a whole data. The study of biochemical and histological changes in fish liver has become an important diagnostic tool for environ-mental exposure of fish to contaminants in laboratory and field studies (Figueiredo-Fernandes et al., 2006). It is known that en-vironmental contaminants can alter biochemical and physiological parameters infish. Especially these toxic contaminants cause cy-totoxic effects by the production of a ROS which can induce oxi-dative damage and may be a mechanism of toxicity for aquatic organisms living in polluted areas (Pandey et al., 2003; Li et al., 2010).
Although there are quite few papers elucidating the toxic ef-fects of glyphosate on aquatic organisms, we think that there are many points waiting to clarify. One of these points is where do the toxic effects of glyphosate on antioxidant enzymes come from? Whether it is from inhibition effects on enzyme activity after translation or from inhibition of transcription needs to be ad-dressed. The key antioxidative enzymes for the detoxification of ROS found in all organisms are superoxide dismutase (SOD), cat-alase (CAT) and glutathione peroxidase (GPx). SOD, CAT and GPx, together with GSH-S-transferase and GSH reductase, are easily induced by oxidative stress, and the activity levels of these en-zymes have been used to quantify oxidative stress in cells (Van der Oost et al., 2003;Olsvik et al., 2005).
The other point is how the glyphosate toxicity changes the histology of liver, which is generally regarded as the central organ of xenobiotic metabolism infish, and affects the liver antioxidant parameters. So, structural damages from the effects of pollutants on liver metabolism have been supported by the results of histo-pathological studies (Jiraungkoorskul et al., 2003a). Moreover histopathology provides information on the effects of irritants in various organs (Capkin et al., 2009).
The last point tried to be clarified in this study is alterations of swimming performance as a behavioural change against to gly-phosate toxicity combined with the other data. It is well known that swimming is the only option most aquatic preys possess to escape from the predators and swimming capacity is directly re-lated to food capture, habitat shifts and reproduction (Webb, 1984, Videler and Nolet, 1990). It is thus of high ecological importance, and presumed to be subjected to selection pressures that enhance fitness (Priede, 1985). Energetic costs of swimming are influenced by a variety of environmental factors including xenobiotics such as pesticides (Ohlberger et al., 2005).
2. Materials and methods
2.1. Fish Husbandry and maintenance
The juvenile fish samples were provided from the rainbow
trout farm of the Department of Aquaculture, Ataturk University. The livefish used in this study were healthy and with an average body mass of 3.270.7 g and average length of 7.871.5 cm. At the time of sample collection,fish were fed with a commercial trout feed at 2% body weight thrice a day. Prior to the experiment,fish in each group were kept in 25 50 50 cm3 (W L H) glass
aquarium for one month. Aeration was provided along the ex-periments. The average water temperature was maintained at 972 °C during the study by circulating cold water around the aquariums. Two-thirds of water in aquarium was replaced every day. The water quality parameters were measured as O2¼9.1 mg/L,
pH¼7.0, SO42¼0.33 mg/L, PO43¼trace, NO3¼1.45 mg/L, and
NO2¼trace. The average dissolved oxygen level was adjusted to
9.1 ppm and maintained by means of a ventilation system. Two aquariums were used as controls with no pesticides, one for acute other for chronic treatments, while others were added 2.5, 5 and
10 mg/L pesticide for short term treatments, and 2.5 and 5 mg/L pesticide for long term treatment.
The commercial formulation of glyphosate (N-phosphono-methyl glycine, 360 mg/L) was used in this study and was pur-chased from a distributor company (Turkey). Stock solution of glyphosate was prepared by dissolving in distilled water. The commercial formulation of glyphosate was used in this study and was purchased from a distributor company (Turkey). The LC 50 value for rainbow trout of glyphosate was 8.3 mg/L. The nominal concentrations used for this study were 2.5 mg/L, 5 mg/L and 10 mg/L. We have chosen these nominal concentrations because it is lower than lethal concentrations for rainbow trout. It has been also reported that roundup concentrations tested on the sub-lethal
experiments (7.5 and 10 mg/L) might be considered
en-vironmentally realistic considering current application rates (Langiano Vdo and Martinez, 2008). Glyphosate is often detected in many rivers, agricultural and urban regions, and might pose considerable damage tofish (Pesce et al., 2008).
Experiments were started with 60fish in each aquarium. Fol-lowing pesticide administration, ten fish were chosen randomly from each aquarium for short term treatments at 6th, 12th, 24th, 48th, 96th h and for long term treatment at 21st day. Stock density was maintained by reducing the water level while sampling. After finishing the treatments, remaining fish were kept in fresh water for 24 h for acute group and 48 h for chronic group in fresh water. Liver tissue samples, collected fromfive of ten randomly cho-senfish in each aquarium at the sampling time, were divided into two equal parts. One part used for enzyme assay described below and other part immediately frozen in liquid nitrogen and stored 80 °C until RNA isolation. And the liver tissue samples from re-mainingfive of the ten fish were obtained and fixed in 10% buf-fered formalin solution for histopathological analyses.
2.2. Enzyme Assays
2.2.1. Preparation of the homogenate
Liver tissue samples, collected fromfive randomly chosen fish in each aquarium at the sampling time, were divided into two equal parts. Thefirst part was washed thrice with 50 mM Tris–HCl, containing 0.1 M Na2SO4(pH 8.0), homogenised in the presence of
liquid nitrogen, resuspended in the same buffer, and centrifuged at 4°C, 15,000 g for 60 min (Le Trang et al., 1983). The supernatant was immediately used for the experiments.
2.2.2. Determination of enzyme Activities
Superoxide dismutase (SOD) (EC 1.15.1.1) activity was assayed by the method of Giannopolitis and Ries (1977). The reaction mixture contained 50 mM phosphate buffer (pH 7.8), 0.1
μ
M EDTA, 13 mM methionine, 75μ
M nitro-blue tetrazolium (NBT), 2μ
M ri-boflavin, and 50μ
L enzyme fraction. The mixture was incubatedfor 25 min at 20°C and measured as spectrophotometric at
560 nm. One enzyme unit was defined as SOD activity that inhibits 50% of NBT reduction.
Catalase (CAT) (EC 1.11.1.6) activity was measured according to the method ofAebi (1984). The reaction mixture contained 25 mM sodium phosphate buffer (pH 7.0), 10 mM H2O2, and 0.01 mL
en-zyme fraction. For assaying of CAT activity was added 2.99 and 2.98 mL phosphate buffer (pH¼7.0) to a test tube for each blank or sample, respectively and added 0.01 mL H2O2 to each blank or
sample tubes, and 0.01 mL sample was added to the sample tube. After this, the mixture was immediately measured at 240 nm spectrophotometrically at 20°C. One enzyme unit is defined as the amount that disproportionate 1% H2O2in 1 min.
Glutathione peroxidase (GPx) (EC 1.11.1.7) activity was de-termined according to the method of Herzog and Fahimi (1973). The reaction mixture contained 50 mM phosphate buffer (pH 6.0),
0.1 M reduced glutathione (GSH), 10 U/ml Glutathione reductase (GR), 2 mM NADPH, and 0.1 mL enzyme fraction. For assaying of GPx activity was initiated with 7 mM t-Butyl hydroperoxide to a test tube for only sample. Before measurement mixture was in-cubated 10 min at 37°C than activity measurement was performed at 340 nm spectrophotometrically. One enzymatic unit was de-fined as 1 mmol of oxidized NADPH per minute at 30 °C by the glutathione reductase.
2.2.3. Quantitative estimation of protein
The quantity of protein was estimated spectrophotometrically at 595 nm according to Bradford's method (Bradford, 1976) using bovine serum albumin as the standard.
2.3. Real-time assay
2.3.1. RNA isolation and cDNA synthesis
Total RNA was isolated from the second part liver tissue sam-ples of each group using High Pure RNA tissue kit (Roche) ac-cording to manufacturer's protocol. The concentrations and quality of the purified RNA were estimated by spectrophotometery (Na-nodrop) and RNA gel electrophoresis, respectively. cDNA synthesis was performed using the Transcriptor First Strand cDNA Synthesis Kit (Roche) according to the manufacturer's protocol. The cDNAs were stored at 20 °C until further use.
2.3.2. Primer and TaqMan probe design
Primers and TaqMan probe were designed in Primer3software (v. 0.4.0) (http://frodo.wi.mit.edu/) using rainbow trout CAT, SOD, GPx and GAPDH sequence (GenBank accession numbers are BE669040.1, NM_001160614.1, AY622862.1 and NM_001124246, respectively) and BLAST searched to ensure correctness of mRNA sequences. In order to perform multiplex Real Time PCR, TaqMan probe of the housekeeping gene was conjugated with
Cy5/Black-hole Quencher 2, the fluorophore and quencher molecules,
whereas the probes for target genes were conjugated with FAM/ TAMRA (Ceyhun et al., 2011). The primer and probe sequences are provided inTable 1.
2.3.3. Real-time PCR
Quantification of gene expression by real-time PCR analysis was performed using a Stratagene MxPro3000 thermal cycler. The PCR was carried out in a reaction volume of 50
μ
l containing template DNA, 900 nM of forward and reverse primers, 250 nM TaqMan probe, and 25μ
l FastStart TaqMan Probe Master (Applied Biosystems) which consisted of AmpliTaq Gold DNA Polymerase,Table 1
Sequence of primers and probe sets used for transcriptional analayses. Primers/
probes
Sequence 5′-3′ Amplification size (bp) CAT Forward TGGCTTTGCAGTCAAGTTCTAC 87 CAT Reverse CTTCTTTATCAGGGACGCCAT
CAT TaqMan Prob
FAM- TGACGAGGGCAACTGGGACCTT -TAMRA
SOD Forward ACGGACTTTGTGAACTTGCAG 85 SOD Reverse TGTTACCGGGACCGTATTCTT
SOD TaqMan Prob
FAM- TGCTGAAGGCTGTTTGCGTGCT -TAMRA
GPx Forward AGCAGCACACCCATTACCTT 130 GPx Reverse TGTGAGAGGGATGTCTGATGA
GPx TaqMan Prob
FAM- TCATGTGCCGTGCTCTCATATGCA -TAMRA
GAPDH Forward ATCAAAGGGGCTGTCAAGAA 106 GAPDH Reverse AGGAGTGGGTGTCTCCAATG GAPDH Taq-Man Prob Cy5- CGCCGAAGGACCCATGAAGG -BQ2
Fig. 1. The combined graph includes; 1. Antioxidant enzyme activity (superoxide dismutase (A), catalase (B) and glutathione peroxidase (C)) levels in the liver tissues of juvenile rainbow trout after short term exposures to three different doses of glyphosate and during 24 hours recovery treatment in column chart with axis. 2. Critical swimming speed (Ucrit) changes after short term exposures to three
dif-ferent doses of glyphosate and during 24 hours recovery treatment has been dis-played in line graph without axis (A–C). 3. The table located bottom of graph refers to histopathological alterations (hyperaemia, degeneration of hepatocyte, cellular infiltration and fibrosis) in liver tissues of juvenile rainbow trout after short term exposure to three different doses of glyphosate and during 24 h recovery treatment (A–C). The scores were derived as semi-quantitatively according to the severity and degree and were reported as follows: none:, mild: þ, moderate: þ þ, severe: þ þ þ. a,b,c,d: statistical differences between different time points of each dosage. A–C: statistical differences between different dosages of each time point.
AmpErase uracil N-glycosylase (UNG), dNTP with dUTP, and
opti-mised buffer component. Amplification and detection of the
samples and the standards were performed using the following thermal cycling conditions: 50°C for 2 min for activation of optical AmpErase UNG enzyme, 95°C for 10 min as hot start to activate AmpliTaq Gold DNA polymerase followed by 45 cycles of dena-turation at 95°C for 15 s, and annealing and extension at 60 °C for 1 min.
2.4. Histopathology
Liver tissue samples from remainingfive of the ten fish were obtained and fixed in 10% buffered formalin solution. After the routine alcohol–xylol processing, tissue samples were embedded in paraffin wax and sectioned as 5 mm thin slices. All sections were
stained with haematoxylin and eosine (HE) (Presnell and
Schreibman, 1997). Histopathological changes were semi-quanti-tatively assessed under the light microscope (Olympus BX51 with
DP72 camera attachment system). Ten microscopic fields were
randomly chosen after the general examination in 4x, 20x and 40x magnification. The scores were derived semi-quantitatively ac-cording to the severity and extent, and were reported as follows: none: (no lesion), mild:þ(1–3 fields with lesions), moderate: þ þ (4–7 fields with lesions), severe: þ þ þ (8-10 fields with lesions).
2.4.1. Swimming performance assay
Swimming performance was measured for all groups as critical swimming speed (Ucrit) using 1200 swimming performance
sys-tem of Akuamaks Company, Ankara, Turkey. The acrylic syssys-tem was consisted of aflat bottomed tank of 36 cm depth with roun-ded edges with a perimeter of 14.65 m andflat sides. The flat sides were 400 cm in length and attached with four acrylic pedals connected to an engine set on one side and a swimming tunnel on the other side. A modified Brett-type cylindrical swimming tunnel (Brett, 1964) (100 cm length and 40 cm diameter) with semi-oval shaped transparent top (80 cm 30 cm) permitted to follow the movements of thefish. The temperature of water in the swimming
chamber was maintained at 10.070.5 °C and oxygen level at
13.070.5 ppm. The Ucrit was calculated for each fish using the
following equation (Brett, 1964):
= +
Ucrit Uf ( / )t t Uf i i
where, Uf(cm/s) is the highest speed at which thefish swam for
the full time period and Ui(proportionally to the body length) is
the water velocity increment. ti(30 min) denotes the prescribed
period of swimming at a given speed and tf (min) is the time
Fig. 2. The combined graph includes; 1. Relative mRNA expression of antioxidant enzyme gene (superoxide dismutase (A), catalase (B) and glutathione peroxidase (C)) to housekeeping gene (GAPDH) in the liver tissues of juvenile rainbow trout after short term exposure to three different doses of glyphosate and during 24 h recovery treatment in column chart with axis. The histogram represents the mean fold change relative to the control of experiment. 2. Critical swimming speed (Ucrit) changes after short term exposures to three different doses of glyphosate and
during 24 h recovery treatment has been displayed in line graph without axis and control group (A–C). 3. The table located bottom of graph refers to histopatholo-gical alterations (hyperaemia, degeneration of hepatocyte, cellular infiltration and fibrosis) in liver tissues of juvenile rainbow trout after short term exposure to three different doses of glyphosate and during 24 h recovery treatment without control group (A–C). The scores were derived as semi-quantitatively according to the se-verity and degree and were reported as follows: none:, mild: þ, moderate: þ þ, severe: þ þ þ. a, b, c, d: statistical differences between different time points of each dosage. A, B, C: statistical differences between different dosages of each time point.
duration for which thefish swam at the final speed. All absolute Ucrit(cm/s) values were standardised for size by dividing the total
length of thefish to obtain a value in body lengths per second, which denotes relative Ucrit(BL/s) (Beaumont et al., 1995)
2.5. Statistical Analyses
All experiments were repeated at least three times. Both en-zyme and real-time assay data werefirst examined for normality and homogeneity of variances. Differences between groups were detected using an analysis of variance (ANOVA). Following Arc-sine, Two-Way ANOVA and Duncan's multiple range test via SPSS 17.0 was used to determine the toxic effects of glyphosate and po0.05 was considered statistically significant.
3. Results and discussion
3.1. Effects of glyphosate on transcription and enzymatic activity of SOD, CAT and GPx
According to acute enzyme activity results, GPx activity was significantly induced at 12th h after 2.5 mg/L glyphosate treatment and at all recovery processes as compared with the control group. A similar degree of induction was observed for CAT activity but not for SOD. SOD activity was significantly induced only at 6th h after 2.5 and 5 mg/L glyphosate treatment. Otherwise many insignif-icant effects in enzyme activity, changing with time of exposure and dose, were observed. For long term exposure, except for GPx activity after 5 mg/L exposure, all other enzyme activity data did not differ significantly from the control group.
Fig. 3. No histopathological change in control group (a); mild degenerative changes infish exposed to 2.5 mg/L of glyphosate at 12th and 24th h (arrows in b and c); mild cellular infiltration in fish exposed to 2.5 mg/L of glyphosate for 48th–96th h (arrows in d and e); moderate degenerative changes (white arrow in f) and hepatocytes with picnotic nuclei in chronic group of same dose (black arrow in f). Bar¼20 μ. HE.
Fish have evolved advanced defence systems to protect them-selves against the damaging effects of ROS. They can combat high levels of ROS in their systems with the help of antioxidant en-zymes which convert superoxide anions O2– into H2O2and
sub-sequently into H2O and O2(Xing et al., 2012). Thus, it is possible
that the decrease in the activity of the enzymes induced by gly-phosate treatment helps in the elimination of ROS from the cell or it might also be due to the inhibition effects of toxicants. On the other hand,Chang et al., (2013)suggested that when the levels of superoxides reach to a maximum in cell, a gradual decrease ensues due to the self-scavenging of superoxides within the cells. Actually, in order to conclude that these decreases are due to the inhibition effect of toxicant, these results must be correlated together with levels of gene expression level and enzyme inhibition. When these two results are compared with each other (Figs. 1,2, Figs. 2,4,
(Figs. 2 and 4 in Supplementary Material)), it becomes clear that the level of enzyme activity observed is contradictory to the level of expression of the gene. For example, in the case of enzymes, GPx and CAT, while a significant increase in the level of gene expres-sion can be seen at 96th h when compared with 48th and 24th h after 10 mg/L glyphosate treatment, a corresponding surge in the enzyme activity is not observed (Figs. 1b, c, 2b and c). On the contrary, elevated levels of enzyme activity can be observed with simultaneous decreased levels of gene expressions for the fol-lowing cases: GPx– 24th h after 5 mg/L and 10 mg/L glyphosate treatment, CAT– 12th and 48th h after 2.5 mg/L treatment, 12th h after 5 and 10 mg/L glyphosate treatment, and SOD– 6th h after 2.5 mg/L treatment and 24th h after 10 mg/L glyphosate treatment (Figs. 1and2). Xenobiotics have been reported to affect the pro-duction of protein in a variety of ways such as disrupting or
Fig. 4. No histopathological change infish exposed to 5 mg/L of glyphosate for at 6th h (a); mild degenerative changes in fish exposed to 5 mg/L of glyphosate at 12th and 24th h (arrows in b and c); moderate degenerative changes infish exposed to 5 mg/L of glyphosate at 48th–96th h (arrows in d and e); and mild cellular infiltration and fibrosis in chronic group of same dose (arrow in f). Bar¼20 μ. HE.
attenuating protein translation (Melo and Ruvkun, 2012;Dunbar et al., 2012), by reducing translation initiation (Wang et al., 2010), by causing specific changes in post-translational modification (Staudinger et al., 2011) or by inhibiting the activity of enzymes (Ceyhun et al., 2010). The latter effects caused by xenobiotics can be performed via several ways in addition to ways mentioned above to combat the high levels of ROS. The synthesis of essential aromatic amino acids is inhibited via competitive inhibition of the
enzyme enolpyruvylshikimate-3-phosphate synthase (EPSPS)
(Williams et al., 2000). Although this mechanism is specific for plants, glyphosate is also capable of bringing about such inhibi-tion. Several other studies have demonstrated that xenobiotics have the ability to exclude (Salazar et al., 2006) or inhibit (Hanas and Gunn, 1996) transcription factors. Moreover, the activity of transcription factors is dependent upon the reduced or oxidised state of redox-responsive moieties; consequently, oxidative stress
can alter the activity of transcription factors by altering the redox status of the cell (Giulio and Meyer, 2008). In addition, alternative splicing has been implicated in numerous diseases such as cancer and neurodegeneration (Zaharieva et al., 2012). Moreover, poly-A tail shortening of mature mRNA also prevents enzymatic de-gradation leading to increased mRNA stability (Brevini et al., 2005). The presence or amount of polysome structure also plays a role. Another possibility is activation of enzyme chemically after translation or during translation by inducing translation factors (Dudek et al., 2013).
3.2. Effects of glyphosate on lesion of liver tissue
In the present study, there was no histopathological changes in control group (Fig. 3a) and at 6th h of the treatment with 2.5 and 5 ppm glyphosate (Fig. 4a). Limited hyperaemia was observed with
Fig. 5. Hyperemia infish exposed to 10 mg/L of glyphosate at 6th h (arrow in a); mild degenerative changes in fish exposed to 10 mg/L of glyphosate at 12th and 24th h (arrows in b and c); moderate degenerative changes andfibrosis in fish exposed to 10 mg/L of glyphosate at 48th–96th h (arrows in d–f). Bar¼20 μ. HE.
10 mg/L glyphosate (Fig. 5a). Mild degenerative changes were observed at 12th and 24th h in all experimental groups (Figs. 3–5, panel b and c only). There were moderate degenerative changes at 96th h and in long term exposure group with a 2.5 mg/L dose (Fig. 3e and f); at 48th and 96th h with 5 mg/L dose (Fig. 4d and e) and at 48th and 96th h with 10 mg/L dose (Fig. 5d and e). Limited cellular infiltration was seen in chronic groups with a 5 mg/L dose (Figs. 4f and5f). Histopathological changes observed in recovery treatment group of short term treatments were similar to that observed at 96th h exposure. Similarly, histopathological changes observed in chronic treatment were found in recovery treatment group as well.
The harmful effects of glyphosate on the liver histology of ju-venile rainbow trout may depend on the duration of exposure (chronic or acute) and the concentration of the toxicant. As shown in the table locatedFigs. 1,2,Figs. 2and4(Figs. 2 and 4 in Sup-plementary Material) degenerations andfibrosis in hepatic tissue were common. Mild degenerative changes were observed in early stages (after 12–24 h) of lower doses (2.5 and 5 mg/L doses) of glyphosate. Marked degeneration was seen after 48 h with 5 and 10 mg/L doses. Limitedfibrosis was seen in only chronic groups of 5 and 10 mg/L doses. Histopathological results that have pre-viously been reported in the liver of variousfish species exposed to glyphosate include the following: vacuolation and nuclear py-knosis, (Oreochromis niloticus) (Jiraungkoorskul et al., 2003b); fatty degeneration, vacuolation, hepatic necrosis and infiltration of leukocytes (Clarias gariepinus) (Ayoola, 2008) and liver damage in carp (Cyprinus carpio) exposed to 5 mg/L of glyphosate for two weeks (Neskovi
ć
et al., 1996).As liver is the major organ for xenobiotic metabolising en-zymes, histopathological changes in liver have been widely used as biomarkers in the evaluation of the health of fish exposed to contaminants, both in laboratory (Thophon et al., 2003) andfield studies (Teh et al., 1997). Fish liver histopathology is an indicator of chemical toxicity and it is a useful way to study the effects of exposure of aquatic animals to toxins present in the aquatic en-vironments (Boran et al., 2010).
3.3. Effects of glyphosate on swimming performance
The swimming of aquatic organisms is closely related to the energetic metabolism and ecological parameters such as food in-take, escape from predator and reproduction (Artells et al., 2013), in addition to stress. Previous studies have shown that the energy metabolism is forced into re-regulation via some receptors (such as xenosensing receptors, constitutive androstane receptor) as a mediator of xenobiotic induction responses, following xenobiotic exposures (Omiecinski et al., 2011). In the present study, it was observed that critical swimming speed (Ucrit) shows variability
dependent on or independent to the time of exposure and dose, in general (Fig. 5(inSupplementary Material)). An increase in Ucrit
after recovery treatment was expected in all treatment groups. Except for the 2.5 mg/L treatment group, the performances of other groups were as speculated. But in general, an increase in Ucrit
was observed in all treatment groups after glyphosate adminis-tration for thefirst two hours as compared with the control group. This behaviour in Ucrit can be explained as an attempt to escape
from toxic area instinctively due to behavioural responses (Elliott et al., 2007). And otherfluctuations could be with associated en-ergy metabolism, stress, enzymatic and amount of enen-ergy utilised for detoxification. Xia et al., (2013) found that although per-fluorooctane sulfonate exposure had marked influences on the swimming oxygen consumption rate and active metabolic rate of goldfish, the Ucritof the goldfish was not significantly affected by
perfluorooctane sulfonate exposure. On the other hand, Wilson et al., (1994)found that exposure to low pH resulted in reduced
Ucritin rainbow trout, and suggested that this was due to increased
metabolic costs for ion regulation. In another report, exposure of fingerling rainbow trout to copper increased standard metabolism by 70% and Ucritwas decreased by 40% in comparison with control
(Waiwood and Beamish, 1978).
Consistent and in correlation with the liver damage, hepatocyte degeneration and fibrosis, the swimming performance declines about a day after the xenobiotic exposures. Although the swim-ming performance later rebounds, it never reaches to the normal level even after the recovery periods. Thus, the xenobiotic may have systemic and/or muscular effects resulting in declined swimming performance. Although inconsistent throughout the exposure times, activities and expression levels of the enzymes changes significantly. Initially this might be due to xenobiotic metabolism and then secondarily as a result of the histological liver damages. If the xenobiotic has effect on extrahepatic tissues, e.g. muscle, this might also cause, as a secondary effect on liver, changes in the activity/expression of the enzymes.
4. General conclusion
Thefish exposed to sublethal doses of glyphosate two or more days exhibits moderate liver degeneration andfibrosis. Similarly, despite rebounding of swimming performance, it declines com-pared to the initial performance and it does not return to normal level after the recovery time. Thus, the xenobiotic may have sys-temic and/or muscular effects resulting in decreased swimming performance. Activity and mRNA expression level of enzymes having roles in ROS clearance and cellular redox state display significant, although sporadic, changes, perhaps initially as a re-sponse to the xenobiotic clearance and then secondarily due to the liver damages.
Acknowledgements
This work was supported by Atatürk University Scientific Re-search Projects (BAP 2012/484, 2012/205). Therefore, we are grateful to Atatürk University, Turkey.
Appendix A. Supplementary material
Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.ecoenv.2014.09. 027.
References
Aebi, H., 1984. Catalase in vitro. Method Enzymol. 105, 121–126.
Artells, E., Issartel, J., Auffan, M., Borschneck, D., Thill, A., et al., 2013. Exposure to cerium dioxide nanoparticles differently affect swimming performance and survival in two daphnid species. PLoS One 8 (8), e71260.
Ayoola, S.O., 2008. Histopathological Effects of Glyphosate on Juvenile African Catfish (Clarias gariepinus). Am. Eurasian J. Agric. Environ. Sci. 4 (3), 362–367.
Bagchi, D., Bagchi, M., Hassoun, E., Stohs, S.J., 1995. In vitro and in vivo generation of reactiveoxygen species, DNA damage and lactate dehydrogenase leakage by selected pesticides. Toxicology 104, 129–140.
Barlow, B.K., Lee, D.W., Cory-Slechta, D.A., Opanashuk, L.A., 2005. Modulation of antioxidant defense systems by the environmental pesticide maneb in dopa-minergic cells. NeuroToxicology 26, 63–75.
Beaumont, M.W., Butler, P.J., Taylor, E.W., 1995. Exposure of brown trout, Salmo trutta, to sub-lethal copper concentrations in soft acidic water and its effect upon sustained swimming performance. Aquat.Toxicol. 33, 45–63.
Boran, H., Altinok, I., Capkin, E., 2010. Histopathological changes induced by maneb and carbaryl on some tissues of rainbow trout, Oncorhynchus mykiss. Tissue Cell 42, 158–164.
Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of micro-gram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254.
Brett, J.R., 1964. The respiratory metabolism and swimming performance of young sockeye salmon. J. Fish. Board Can. 21 (5), 1183–1226.
Brevini, T.A.L., Cillo, F., Antonini, S., Gandolfi, F., 2005. Effects of endocrine dis-rupters on the oocytes and embryos of farm animals. Reprod. Dom. Anim. 40, 291–299.
Capkin, E., Birincioglu, S., Altinok, I., 2009. Histopathological changes in rainbow trout (Oncorhynchus mykiss) after exposure to sublethal composite nitrogen fertilizers. Ecotoxicol. Environ. Saf. 72, 1999–2004.
Ceyhun, S.B., Aksakal, E., Kırım, B., Atabeyoğlu, K., Erdoğan, O., 2011. Chronic toxi-city of pesticides to the mRNA expression levels of metallothioneins and cy-tochrome P450 1A genes in rainbow trout. Toxicol. Ind. Health 28 (2), 162–169.
Ceyhun, S.B., Senturk, M., Ekinci, D., Erdogan, O., Ciltas, A., Kocaman, M., 2010. Deltamethrin attenuates antioxidant defense system and induces expression of heat shock protein 70 in rainbow trout. Comp. Biochem. Physiol. C 152, 215–223.
Chang, Y., Ken, C., Hsu, C., Liu, Y., 2013. Real time in vivo investigation of superoxide dynamics in zebrafish liver using a single-fiber fluorescent probe. Biomed. Opt. Express 4 (9), 1702–1709.
Dudek, K.M., Suter, L., Darras, V.M., Marczylo, E.L., Gant, T.W., 2013. Decreased translation of Dio3 mRNA is associated with drug-induced hepatotoxicity. Biochem. J. 453, 71–82.
Dunbar, T.L., Yan, Z., Balla, K.M., Troemel, E.R., 2012. C. elegans detects pathogen-induced translational inhibition to activate immune signaling. Cell Host Mi-crobe 11 (4), 375–386.
Elliott, M., Hemingway, K.L., Krueger, D., Thiel, R., Hylland, K., Arukwe, A., Förlin, L., Sayer, M., 2007. Effects of Pollution on Fish: Molecular Effects and Population Responses. In: Lawrence, A., Hemingway, K. (Eds.), Blackwell Science Ltd., Ox-ford, UK, p. 225.
Figueiredo-Fernandes, A., Fontaınhas-Fernandes, A., Peixoto, F., Rocha, E., Reis-Henriques, M.A., 2006. Effects of gender and temperature on oxidative stress enzymes in Nile tilapia Oreochromis niloticus exposed to paraquat. Pes-tic. Biochem. Physiol. 85, 97–103.
Folmar, L.C., Sanders, J.O., Julin, A.M., 1979. Toxicity of the herbicide glyphosate and several of its formulations tofish and aquatic invertebrates. Arch. Environ. Contain. Arch. Environ. Contam. Toxicol. 8, 269–278.
Giannopolitis, C.N., Ries, S.K., 1977. Superoxide dismutase in higher plants. Plant Physiol. 59, 309–314.
Giulio, R.T.D., Meyer, J.N., 2008. Toxicology of Fisheries. Giulio, R.T.D. and Hilton, D. E. (ed.). Reactive Oxygen Species and Oxidative Stress, .. CRC Press, Taylor & Francis Group, Broken Sound Parkway NW p. 288 (Suite 300 Boca Raton).
Hanas, J.S., Gunn, C.G., 1996. Inhibition of transcription factor IIIA-DNA interactions by xenobiotic metal ions. Nucleic Acids Res. 24 (5), 924–930.
Herzog, V., Fahimi, H., 1973. Determination of the activity of peroxidase. Anal. Biochem. 55, 554–562.
Jiraungkoorskul, W., Upatham, E.S., Kruatrachue, M., Sahaphong, S., Vichasri-Grams, S., Pokethitiyook, P., 2003a. Biochemical and histopathological effects of gly-phosate herbicide on Nile tilapia (Oreochromis niloticus). Environ. Toxicol. 18 (4), 260–267.
Jiraungkoorskul, W., Upatham, E.S., Kruatrachue, M., Sahaphong, S., Vichasri-Grams, S., Pokethitiyook, P., 2003b. Biochemical and histopathological effects of gly-phosate herbicide on Nile tilapia (Oreochromis niloticus). Environ. Toxicol. 18, 260–267.
Kreutz, L.C., Gil Barcellos, L.J., de Faria Valle, S., de Oliveira Silva, T., Anziliero, D., Davi dos Santos, E., Pivato, M., Zanatta, R., 2011. Altered hematological and immunological parameters in silver catfish (Rhamdia quelen) following short term exposure to sublethal concentration of glyphosate. Fish Shellfish Im-munol. 30 (1), 51–57.
Langiano Vdo, C., Martinez, C.B., 2008. Toxicity and effects of a glyphosate-based herbicide on the Neotropicalfish Prochilodus lineatus. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 147 (2), 222–231.
Le Trang, N., Bhargava, K.K., Cerami, A., 1983. Purification of glutathione reductase from gerbil liver in two steps. Anal. Biochem. 133, 94–99.
Lee, R.F., Steinert, S., 2003. Use of the single cell gel electrophoresis/comet assay for detecting DNA damage in aquatic (marine and freshwater) animals. Mutat. Res. 544, 43–64.
Li, Z.H., Zlabek, V., Li, P., Grabic, R., Velisek, J., Machova, J., Randak, T., 2010. Bio-chemical and physiological responses in liver and muscle of rainbow trout after long-term exposure to propiconazole. Ecotoxicol. Environ. Saf. 73 (6), 1391–1396.
Mathew, G., Vijayalaxmi, K.K., Rahiman, M.A., 1992. Methyl parathion-induced sperm shape abnormalities in mouse. Mutat. Res. 280, 169–173.
Melo, J.A., Ruvkun, G., 2012. Inactivation of Conserved C. elegans Genes Engages Pathogen- and Xenobiotic-Associated Defenses. Cell 149, 452–466.
Nesković, N.K., Poleksić, V., Elezovíc, I., Karan, V., Budimir, M., 1996. Biochemical and histopathological effects of glyphosate on carp, Cyprinus carpio. Bull. En-viron. Contam. Toxicol. 56, 295–302.
Ohlberger, J., Staaks, G., Van Dijk, P.M.L., Hölker, F., 2005. Modeling energetic costs offish swimming. J. Exp. Zool. 303A (8), 657–664.
Olsvik, P.A., Kristensen, T., Waagbø, R., Rosseland, B.O., Tollefsen, K.E., Baeverfjord, G., Berntssen, M.H., 2005. mRNA expression of antioxidant enzymes (SOD, CAT and GSH-Px) and lipid peroxidative stress in liver of Atlantic salmon (Salmo salar) exposed to hyperoxic water during smoltification. Comp. Biochem. Phy-siol. C 141, 314–323.
Omiecinski, C.J., Vanden Heuvel, J.P., Perdew, G.H., Peters, J.M., 2011. Xenobiotic metabolism, disposition, and regulation by receptors: from biochemical phe-nomenon to predictors of major toxicities. Toxicol. Sci. 120 (S1), 49–75.
Pandey, S., Parvez, S., Sayeed, I., Haque, R., Bin-Hafeez, B., Raisuddin, S., 2003. Biomarkers ofoxidative stress: a comparative study of river Yamunafish Wal-lago attu (Bl. &Schn.). Sci. Total Environ. 309, 105–115.
Pesce, S., Fajon, C., Bardot, C., Bonnemoy, F., Portelli, C., Bohatier, J., 2008. Long-itudinal changes in microbial planktonic communities of a French river in re-lation to pesticide and nutrient inputs. Aquat. Toxicol. 86, 352–360.
Presnell, J., Schreibman, M.P., 1997. Animal Tissue Techniques, 5th ed. The Johns Hopkins University Pres Ltd., London, pp. 269–271.
Priede, I.G., 1985. Metabolic scope infishes. In: Tytler, P., Calow, P. (Eds.), Fish En-ergetics: New Perspectives. The John Hopkins University Press, Baltimore, pp. 33–64.
Salazar, M., Rojo, A.I., Velasco, D., 2006. Glycogen synthase kinase-3βinhibits the xenobiotic and antioxidant cell response by direct phosphorylation and nuclear exclusion of the transcription factor Nrf2. J. Biol. Chem. 281 (21), 14841–14851.
Staudinger, J.L., Xu, C., Biswas, A., Mani, S., 2011. Post-translational modification of pregnane x receptor. Pharmacol. Res. 64, 4–10.
Teh, S.J., Adams, S.M., Hinton, D.E., 1997. Histopathological biomarkers in feral freshwaterfish populations exposed to different types of contaminant stress. Aquat. Toxicol. 37, 51–70.
Thophon, S., Kruatrachue, M., Upatham, E.S., Pokethitiyook, P., Sahaphong, S., Jar-itkhuan, S., 2003. Histopathological alterations of white seabass, Lates calcalifer, in acute and subchronic cadmium exposure. Environ. Pollut. 121, 307–320.
Van der Oost, R., Beyer, J., Vermeulen, N.P.E., 2003. Fish bioaccumulation and bio-markers in environmental risk assessment: a review. Environ. Toxicol. Phar-macol. 13, 57–149.
Videler, J.J., Nolet, B.A., 1990. Cost of swimming measured at optimum speed: scaling effects, differences between swimming styles, taxonomic groups and submerged and surface swimming. Comp. Biochem. Physiol. A 97, 91–99.
Waiwood, K.G., Beamish, F.W.H., 1978. Effects of copper, pH and hardness on the critical swimming speed of rainbow trout (Salmo gairdneri Richardson). Water Res. 12, 611–619.
Wang, J., Robida-Stubbs, S., Tullet, J.M., Rual, J.F., Vidal, M., Blackwell, T.K., 2010. RNAi screening implicates a SKN-1-dependent transcriptional response in stress resistance and longevity deriving from translation inhibition. PLoS Genet. 6 (8), e1001048.
Webb, P.W., 1984. Body form, locomotion and foraging in aquatic vertebrates. Am. Zool. 24, 107–120.
Williams, G.M., Kroes, R., Munro, I.C., 2000. Safety evaluation and risk assessment of the herbicide roundup and its active ingredient, glyphosate, for humans. Reg-ul. Toxicol. Pharmacol. 31, 117–165.
Wilson, R.W., Wright, P.M., Munger, S., Wood, C.M., 1994. Ammonia excretion in freshwater rainbow trout (Oncorhynchus mykiss) and the importance of gill boundary layer acidification: lack of evidence for Naþ/NH4þ exchange. J. Exp. Biol. 191, 37–58.
Xia, J., Fu, S., Cao, S., Peng, J., Peng, J., Dai, T., Cheng, L., 2013. Ecotoxicological effects of waterborne PFOS exposure on swimming performance and energy ex-penditure in juvenile goldfish (Carassius auratus). J. Environ. Sci. 25 (8), 1672–1679.
Xing, H., Li, S., Wang, Z., Gao, X., Xu, S., Wang, X., 2012. Histopathological changes and antioxidant response in brain and kidney of common carp exposed to atrazine and chlorpyrifos. Chemosphere 88, 377–383.
Zaharieva, E., Chipman, J.K., Soller, M., 2012. Alternative splicing interference by xenobiotics. Toxicology 296, 1–12.