Alpha-lipoic acid may ameliorate testicular damage by targeting dox-induced
altered antioxidant parameters, mitofusin-2 and apoptotic gene expression
Article in Andrologia · February 2021DOI: 10.1111/and.13990 CITATIONS 0 READS 32 3 authors:
Some of the authors of this publication are also working on these related projects:
Ayfer YildirimView project
Tobacco smokeView project Elif Erdem Guzel
Mardin Artuklu Üniversitesi
14PUBLICATIONS 12CITATIONS SEE PROFILE
Nalan Kaya Tektemur
Firat University 32PUBLICATIONS 136CITATIONS SEE PROFILE Ahmet Tektemur Firat University 39PUBLICATIONS 77CITATIONS SEE PROFILE
All content following this page was uploaded by Elif Erdem Guzel on 09 March 2021.
Andrologia. 2021;53:e13990. wileyonlinelibrary.com/journal/and
|
1 of 11 https://doi.org/10.1111/and.13990© 2021 Wiley-VCH GmbH
1 | INTRODUCTION
Doxorubicin (DOX), an anthracycline antibiotic, has been used for treating tumours and various cancer, for example, the breast, liver, colon cancer, lymphoma and leukaemia (Gharanei et al., 2013; Gorini et al., 2018). However, its clinical use is restrained owing to the dose-dependent toxicity on testes and other tissues (e.g. the brain, heart, kidney, liver, lung, bone, stomach and ovary) (Ayla et al., 2011; Yeh et al., 2009). DOX has negative effects on the male reproductive system, and thus, it may cause male infertility (Türedi et al., 2015). Although no definite mechanism has been
clarified, recent studies have pointed to the potential role of oxi-dative stress, cellular apoptosis, lipid peroxidation, generation of excessive reactive oxygen species (ROS) and mitochondrial disrup-tion in the DOX-induced testicular toxicity (Öztürk et al., 2020; Yeh et al., 2009).
Mitochondrial dysfunction has been associated with several pa-thologies, including male infertility (Singh et al., 2010). DOX-mediated increased ROS levels lead to a change in mitochondrial dynamics and induce apoptotic signalling (Yeh et al., 2009). Furthermore, investigations demonstrate that DOX disturbs the dynamic bal-ance between mitochondrial fusion and fission, which is crucial for Received: 2 December 2020
|
Revised: 2 January 2021|
Accepted: 7 January 2021DOI: 10.1111/and.13990
O R I G I N A L A R T I C L E
Alpha-lipoic acid may ameliorate testicular damage by targeting
dox-induced altered antioxidant parameters, mitofusin-2 and
apoptotic gene expression
Elif Erdem Guzel
1| Nalan Kaya Tektemur
2| Ahmet Tektemur
31Department of Midwifery, Faculty of
Health Sciences, Mardin Artuklu University, Mardin, Turkey
2Department of Histology and Embryology,
Faculty of Medicine, Firat University, Elazig, Turkey
3Department of Medical Biology, Faculty of
Medicine, Firat University, Elazig, Turkey
Correspondence
Elif Erdem Güzel, Department of Midwifery, Faculty of Health Sciences, Mardin Artuklu University, Mardin, Turkey.
Funding information
Mardin Artuklu University Scientific Research Projects Management Unit, Grant/ Award Number: M. A.Ü.BAP. 18.SYO.010
Abstract
In the study, the ameliorating effects of alfa lipoic acid (ALA) against doxorubicin-in-duced testicular apoptosis, oxidative stress and disrupted mitochondrial fusion were investigated in male rats. Rats were divided into four groups as control, doxorubicin (DOX), DOX + ALA and ALA. A single dose of 15 mg/kg DOX was administered i.p to the DOX and DOX + ALA groups. 50 mg/kg ALA was given to the DOX + ALA and ALA groups by oral gavage every other day. After 28 days, rat testes and serum sam-ples were collected and analysed. Administration of DOX alone caused a decrease in body and relative testicular weights, seminiferous tubule diameter and germinal epithelium thickness, Johnsen's score and serum testosterone levels. DOX treatment led to severe testicular damage such as tubular degeneration, and atrophic tubules. Also, the activities of superoxide dismutase and glutathione peroxidase were re-duced, while the level of malondialdehyde was increased in the testis. The mRNA lev-els of apoptotic-related genes (CASP3, TP53, BAX, BCL2) and apoptotic index were increased, while mitofusin-2 decreased. DOX caused an increase in CASP3 and a decrease in mitofusin-2 immunoreactivities. Treatment with ALA markedly improved all of DOX-induced biochemical, histochemical and molecular alterations in rat tes-tis. Consequently, ALA has a therapeutic role in ameliorating DOX-induced testicular damage in rats.
K E Y W O R D S
mitochondrial function (Marechal et al., 2011). Mitofusin-2 (MFN2), a protein involved in the mitochondrial fusion process, is located in the mitochondrial outer membrane. It has been reported that MFN2 is required to maintain spermatogonial differentiation and spermato-cyte formation during spermatogenesis, and loss of MFN2 in the tes-tis significantly impairs mitochondrial functions (Chen et al., 2020). However, the role of the MFN2 protein in DOX-induced testicular toxicity was still unclear.
DOX causes the depletion of endogenous antioxidants by in-creasing free radicals generation (Türedi et al., 2015). Currently, there is no influential therapy for the suppression of DOX-induced testicular injury. However, co-treatment with a power-ful antioxidant could be an effective approximation to mitigate the toxic adverse effects of DOX. A non-enzymatic antioxidant alpha-lipoic acid (ALA) functions as an important cofactor in mi-tochondrial biogenesis related to metabolic reactions. Besides, in various studies the anti-inflammatory, anti-cancer, antioxidant and anti-apoptotic properties of ALA have been revealed (El-sayed et al., 2017; Prahalathan et al., 2006). Researches have shown that ALA pre-treatment before DOX administration improves abnor-mal histologic findings, sperm motility and the activities of tes-ticular marker enzymes (Selvakumar et al., 2004; Prahalathan et al., 2005). On the other hand, it has not yet been revealed whether the protective effect of ALA on DOX-induced testicular damage is related to MFN2. This is the first report on the pro-tective effect of co-treatment of DOX with ALA on antioxidant parameters, anti-apoptotic markers, histopathological findings and MFN2 gene expression activities in rat testicular tissue. This study purposed to highlight the role of ALA against DOX-induced testicular toxicity, by evaluating MFN2, antioxidants enzyme ac-tivities (superoxide dismutase (SOD) and glutathione peroxidase (GPx)), lipid peroxidation (MDA level), morphometric parameters (Seminiferous tubule diameter (STD) and germinal epithelium thickness (GET)), apoptotic signalling and testosterone levels.
2 | MATERIALS AND METHODS
2.1 | Ethical approval
The study was confirmed by the local ethics committee of the Firat University in Elazığ (Ethic no: 13.07.2016, 2016/133) adhered to European Union guidelines (2010/ 63/EU). All administrations on animals were carried out according to ARRIVE (Animal Research: Reporting of In Vivo Experiments) instructions.
2.2 | Chemicals
DOX was purchased from Deva Farma. Lyophilised DOX powder is reconstituted with sterile water for injection to a final concentration of 2 mg/ml. ALA (cat: 29,862 Lot: 002241–20,161,019, DL-a-Lipoic acid) was bought from Chem-Impex Int'l Inc, USA.
2.3 | Experimental design
Twenty-eight Sprague-Dawley male rats (200–250 g weight, 8–10 weeks old) were obtained from the Firat University Experimental Research Unit (FUDAM). The rats were housed under optimal conditions (food, temperature, water, light). Rats were ran-domly divided into four groups (n = 7): control, doxorubicin (DOX), doxorubicin + alpha-lipoic acid (DOX + ALA) and alpha-lipoic acid (ALA). No application was made to the rats in the control group dur-ing the experimental period. In the DOX and DOX + ALA groups, a single intraperitoneal (i.p.) dose of 15 mg/kg DOX was administered (Öztürk et al., 2020). In the DOX + ALA and ALA groups, 50 mg/kg ALA dissolved in saline was administered every other day by oral gavage for 28 days (El-Sayed et al., 2017). 24 hr after the end of the experiment, the animals were weighed and decapitated with the guillotine. Testicles were rapidly removed and weighed. Left testes were used for histopathological, immunohistochemical and morpho-logical evaluations whereas right testes were stored at −80°C for quantitative real-time RT-PCR (qRT-PCR) analysis and biochemical examinations. Blood was sampled from the trunk of decapitated rats and centrifuged at 1792 g for 5 min at +4°C. Then, the serum sam-ples were stored at—20°C until the subsequent analyses.
2.4 | Calculation of body weight and relative
testis weight
After decapitation, the testis tissues of male rats were removed from peripheral fat tissues and then calculated the relative testis weights (Relative testis weight = (right and left testicular total weights (g) / body weight) × 100.
2.5 | Morphometric measurements
STD and GET (μm) were calculated in each group by a light micro-scope (NovelN- 800M, Ningbo, China) at × 20 magnifications. The measurement of the round-shaped seminiferous tubules was taken. The STD was measured along the minor and major axes, and the mean diameter was acquired in micrometres. GET was calculated by taking equal distance and averages of each cross-section of seminif-erous tubules.
2.6 | Histological evaluation
Testes, fixed in 10% formalin, were embedded in paraffin blocks. 5 µm sectioned paraffin blocks were stained with haematoxylin and eosin (H&E). Spermatogenesis was appraised to Johnsen's mean tes- ticular biopsy score (JMTBS) (Table 1) (Johnsen, 1970). 60 seminifer-ous tubules were randomly selected and assessments were made. Johnsen scoring is a system that evaluates the progress of germinal epithelial degeneration and loss of mature cell type during testicular
damage. Each tubule is scored from 1 to 10; 1 being without germ cells and Sertoli cells whereas 10 being complete spermatogenesis and excellent tubules existent. All testicular histology was investi-gated by two blinded histologists under light microscopy (NovelN- 800M, Ningbo, China).
2.7 | Immunohistochemical evaluation
The avidin-biotin-peroxidase complex method was used to de-termine MFN2 (YID-3452 lot No: YL190228094, Polyclonal Anti-Mitofusin-2 Antibody, YLBiont, Shangai, China) and Caspase-3 (CASP3) immunoreactivities (PA5-16335 lot No: QD2017719, Polyclonal Anti-Caspase-3 Antibody, Thermo Scientific) in testis tis-sue. 15 seminiferous tubules were counted in each slide. The im-munohistochemical histoscores were created on the foundation of immunoreactivity prevalence (0.1: <25%, 0.4:26%–50%, 0.6:51%– 75%, 0.9:76%–100%) and severity (0: no, +0.5: very little, +1: little, +2: medium, +3: severe; Histoscore = prevalence ×severity). For
MFN2, the cells with brown cytoplasmic staining were considered positive whereas, for CASP3, the cells with brown cytoplasmic and nuclear staining were considered positive. Slides were counter-stained with haematoxylin.
2.8 | Terminal deoxynucleotidyl
transferase-mediated deoxyuridine-biotin nick end labelling
(TUNEL) assay method
TUNEL method was used to determine apoptosis. ApopTagPlus Peroxidase in Situ Apoptosis Detection Kit (Chemicon, cat no: S7101, USA) was used to visualise the apoptotic cells. In the evalu-ation of TUNEL staining, the cells with blue nuclei were considered healthy, while the nuclei of apoptotic cells were brown. 250 cells were counted in 25 randomly selected fields. The apoptotic index (%) was calculated as a ratio of the TUNEL positive cell number to the total cell number (Karaguzel et al., 2012).
2.9 | Quantitative RT-PCR method
qRT-PCR method was used to detect gene expression levels of tumour protein p53 (TP53), BCL2-associated X apoptosis regula-tor (BAX), BCL2 apoptosis regularegula-tor (BCL-2), CASP3, MFN2, mi-croRNA 34a (miR-34a), mimi-croRNA 92a (miR-92a) and mimi-croRNA 449a-5p (miR-449a-5p). To isolate total RNA from rat testis tis-sue samples, maintained at −80°C, Trizol (MG-TRZ-01 Hibrigen, Turkey) was used. RNA isolation was performed by the protocol recommended by the manufacturer. Quality and amounts of RNA were analysed in a nanodrop device (BioSpec-nano, Shimadzu). cDNA synthesis was performed using the OneScript Plus cDNA synthesis kit (abm, Canada) according to the manufacturer's rec-ommended protocol. But, instead of the random primer of the TA B L E 1 Johnsen's mean testicular biopsy score (JMTBS)
Score Description
1 No cells
2 Sertoli cells without germ cells
3 Only spermatogonia
4 Only a few spermatocytes
5 Many spermatocytes
6 Only a few early spermatids
7 Many early spermatids without differentiation
8 Few late spermatids
9 Many late spermatids
10 Full spermatogenesis
TA B L E 2 Primer list of miRNAs used in the study
Gene name Symbol Primer sequence (5′−3′)
U6 spliceosomal RNAa U6 RT AACGCTTCACGAATTTGCGT
F CTCGCTTCGGCAGCACA
R AACGCTTCACGAATTTGCGT
MicroRNA 34a miR−34a RT GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACTAGGGC
F GCGGCGGAATCAGCAAGTATACT
R GTGCAGGGTCCGAGGT
MicroRNA 92a miR−92a RT GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCAGGCC
F GCGGCGGCAAAGTGCTGTTCGTGC
R GTGCAGGGTCCGAGGT
MicroRNA 449a−5p miR−449a−5p RT GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACACCAGC
F GCGGCGGTGGCAGTGTATTGTTA
R GTGCAGGGTCCGAGGT
Abbreviations: F, Forward primer; R, Reverse primer; RT, Reverse transcription primer for cDNA synthesis.
cDNA synthesis kit, Reverse Transcription (RT) primers, specific to relevant miRNAs, were used in the cDNAs of miRNAs (Table 2). Obtained cDNAs were amplified by qRT-PCR in the presence of sequence-specific primers. In rat testis samples, U6 spliceosomal RNA (U6) was used as a reference gene to analyse miRNA ex-pression levels and Glyceraldehyde-3 phosphate Dehydrogenase (GAPDH) was used as a reference gene to analyse mRNA expres-sion levels (Table 3). The qRT-PCR analysis was performed in the Applied Biosystems 7500 Real-Time PCR System using the 2X Magic SYBR Mix (Prcomcure, Austria) following the protocol speci-fied by the manufacturer. As a result of the analysis, to calculate
the disparities between the expression levels of genes, the 2−ΔΔCT
method was used.
2.10 | Biochemical analyses
2.10.1 | Measurement of MDA level
Malondialdehyde (MDA) is a marker of lipid peroxidation. Testes samples were homogenised with 0.15 M KCl solution then cen-trifuged at 600 g. 100 μl homogenate is added to 50 μl sodium dodecyl sulphate (SDS, 8.1%), vortexed and incubated for 10 min at room temperature. 375 μl acetic acid (pH 3.5, 20%) and 375 μl thiobarbituric acid (0.6%) were added and kept in a boiling water bath for 60 min. The samples were allowed to cool to room tem-perature. 1.25 ml of butanol: pyridine (15:1) was added, vortexed and centrifuged for 5 min at 112 g. After the MDA reaction with thiobarbituric acid, the reaction product is monitored spectropho-tometrically at 532 nm. Results are defined as nmol / g (Ohkawa et al., 1979).
2.10.2 | Antioxidant SOD and GPx activities
SOD and GPx are antioxidant enzymes that eliminate toxic su-peroxide radicals. The analyzes were performed according to Sun et al. (1988), and results were expressed as U/g protein. GPx activity was determined using the method of Deshpande et al. (2018).
2.10.3 | The measurement of serum
testosterone level
Serum testosterone level was measured using rat enzyme-linked immunosorbent assay (ELİSA) kit (Shanghai Sunred Biological Technology Co, Ltd, China) in respect to the manufacturer's instruc-tions. Testosterone values were expressed as ng/ml. For the testos-terone kit, the assay range was 0.05 ng/ml–15 ng/ml and sensitivity was 0.05 ng/ml.
2.11 | Statistical analysis
All values were expressed as mean ± standard deviation (SD). Statistical analyses were performed with SPSS 21.0, and graphs were created with Origin 6.0. One-way ANOVA (ANalysis Of VAriance) with post hoc Tukey HSD was used for the assessment of the data. The qPCR data were evaluated by using the ΔΔCt mod-ule at the Qiagen Gene Globe Data Analysis Center portal: https:// geneg lobe.qiagen.com/tr/analy ze/. The qPCR module transformed threshold cycle (Ct) values to calculate results for gene expression. In all analyses, p < .05 was considered statistically significant.
TA B L E 3 Primer list of apoptotic and mitochondrial fusion genes used for qPCR
Gene name Symbol Primer sequence (5′−3′) Size (bp) Accession no
glyceraldehyde−3-phosphate
dehydrogenasea GAPDH F GACCCCTTCATTGACCTCAAC 137 NM_017008.4
R CGCTCCTGGAAGATGGTGATGGG
tumour protein p53 Tp53 F GGCTCCTCCCCAACATCTTATC 91 NM_030989.3
R TACCACCACGCTGTGCCGAAAA
BCL2-associated X, apoptosis regulator Bax F GGCTGGACACTGGACTTC 152 NM_017059.2
R CAGATGGTGAGTGAGGCA
BCL2, apoptosis regulator Bcl−2 F GTACCTGAACCGGCATCTG 76 NM_016993.1
R GGGGCCATATAGTTCCACAA
caspase 3 Casp3 F TGCTTACTCTACCGCACCC 481 NM_012922.2
R CAACTACCTGATATCAAAGCTGAG
mitofusin 2 Mfn2 F TCAAGCGCCAGTTTGTGGAG 118 NM_130894.4
R CACAGATGAGCAAATGTCCCAGA
Abbreviations: F, Forward primer; R, Reverse primer.
3 | RESULTS
3.1 | The body weights and relative testes weights
The body weights and relative testes weights in DOX groups showed a significant decrease in comparison to all the other treatment groups (p < .05) (respectively; 384.14 ± 15.38, 304.28 ± 12.72, 335.85 ± 28.92, 402.57 ± 17.83; 0.88 ± 0.05, 0.68 ± 0.06, 0.79 ± 0.06, 0.9 ± 0.01). However, in DOX + ALA group significantly restored the body weight and relative weight of testis than the DOX group (p < .05) (Table 4).
3.2 | Morphometric evaluation of
seminiferous tubules
STD and GET showed a significant decrease in DOX-treated groups compared with all groups (p < .05) (respectively; 292.42 ± 13.78, 202.46 ± 16.89, 270.52 ± 28.83 and 289.92 ± 14.10; 91.15 ± 7.93, 35.15 ± 5.65, 68.35 ± 7.33 and 90.17 ± 6.07). On the other hand, results showed an increase in STD and GET in DOX + ALA-treated groups in comparison with the DOX group (p < .05) (Table 4).
3.3 | JMTBS results
JMTBS results are shown in Table 4. Johnsen's score was found to be significantly decreased in the DOX group compared to all groups (p < .05), while in the DOX + ALA group increased statistically sig-nificantly numerically compared to the DOX (p < .05).
3.4 | Histopathologic findings
In the control and ALA groups, normal structured seminiferous tu-bules, spermatogenic cells and interstitial areas were observed. In the DOX group, atrophic tubules, degeneration in seminiferous tu-bule germinative epithelium and immature cell debris in the tutu-bule lumen were observed in testis. In the DOX + ALA group, although some histopathological findings continued, there was a significant
improvement in germinal germ epithelium and spermatogenesis compared to the DOX group (p < .05). The histopathology exami-nations confirmed that ALA successfully counterbalanced DOX-induced severe degenerative changes of seminiferous tubules (Figure 1).
3.5 | TUNEL findings
TUNEL staining was examined under light microscopy. Apoptotic cells were observed in spermatogenic cell series and Leydig cells (Figure 1;A). The apoptotic index was statistically significantly higher in the DOX group compared to all groups (respectively; 1.42 ± 0.5, 10.37 ± 1.32, 4.76 ± 0.31 and 1.31 ± 0.44 (p < .05) (Figure 1;B). However, a significantly decreased apoptotic index was observed in the DOX ALA group compared to the DOX group (p < .05). Co-treatment with ALA provided protection against DOX-induced in-creased apoptotic cells.
3.6 | Immunohistochemical findings
As a result of microscopic examination MFN2, in the control and ALA groups, a high level of immunoreactivity was observed in the round and elongating spermatid in the seminiferous tubules, while spermatocyte and intertubular Leydig cells were labelled the basal level (Figure 2a). Significantly decreased MFN2 im-munoreactivity was observed in DOX groups compared to all group (respectively; 1.11 ± 0.33, 0.17 ± 0.11, 0.92 ± 0.21 and 1.28 ± 0.37 (p < .05). In the DOX + ALA group, MFN2 immu-noreactivity significantly increased compared to the DOX group (p < .05). ALA treatment increased MFN2 immunoreactivity dis-rupt by DOX.
In the control and ALA groups, weak CASP3 immunoreactions were detected. In DOX administrated group, intense immunostain-ing for CASP3 compared to the control (p < .05). Positive immuno-reactivity was observed in spermatogenic cell series and Leydig cells (Figure 2a). In DOX + ALA-treated group, immunoreaction of CASP3 was detected as moderate staining compared to DOX administered group (p < .05) (respectively, 0.11 ± 0.1, 1.88 ± 0.61, 1 ± 0.19 and TA B L E 4 Results of body and relative testis weights, STD, GET and JMTBS
Groups The body weight (g)
Relative testis
weight (g) STD (μm) GET (μm) JMTBS
Control 384.14 ± 15.38 0.88 ± 0.05 292.42 ± 13.78 91.15 ± 7.93 9.57 ± 0.53
DOX 304.28 ± 12.72a 0.68 ± 0.06a 202.46 ± 16.89a 35.15 ± 5.65a 2.71 ± 0.95a
DOX + ALA 335.85 ± 28.92a,b 0.79 ± 0.06a,b 270.52 ± 28.83a,b 68.35 ± 7.33a,b 7.85 ± 0.69a,b
ALA 402.57 ± 17.83b 0.9 ± 0.01b 289.92 ± 14.10b 90.17 ± 6.07b 9.28 ± 0.48b
Note: Values are given as mean ± standard deviation.
Abbreviations: GET, germinal epithelium thickness; JMTBS, Johnsen's mean testicular biopsy score; STD, seminiferous tubule diameter.
aWhen compared to control group, bWhen compared to DOX group (p < .05).
0.22 ± 0.14). The results of the MFN2 and CASP3 immunoreactivity histoscores are shown in Figure 2b.
3.7 | Quantitative RT-PCR Results
When evaluated in terms of mRNA expression levels, a statisti-cally significant increase in TP53, BAX and CASP3 expressions (p = .013250, p = .009962 and p = .017994, respectively) and a decrease in BCL-2 and MFN2 expressions (p = .006354 and
p
= .007943, respectively) in the DOX group compared to the con-trol group. Compared to the DOX group, statistically significant de-crease in TP53, BAX and CASP3 expressions in both DOX + ALA and ALA groups (p = .008170, p = .016536 and p = .009136, re-spectively) and an increase in BCL-2 and MFN2 expressions (re-spectively p = .004631 and p = .004839) were detected. Compared to the DOX + ALA group, a decrease in TP53 and CASP3 mRNA levels (p = .039611 and p = .043349, respectively) and an increase in BCL-2 mRNA level (p = .039930) were observed in the ALA group (Figure 3a). On the other hand, when evaluated in terms of miRNA expression levels, in the DOX group, only a statistically decrease in miR-449a-5p expression (p = .018559) was determined compared to control group, while no statistically significant change was found in the other groups (p > .05). Compared to the DOX group, a statis-tically significant increase in miR-449a-5p expression (p = .038902) in the DOX + ALA group and an increase in miR-92a expression (p = .026610) in the ALA group were detected. This increase in
miR-449a-5p level targeting p53 in the DOX + ALA group is an indi-cation that ALA decreases apoptotic p53 gene expressions. Only an increase in miR-92a levels (p = .044724) was observed in the ALA group compared to the DOX + ALA group (Figure 3b).
3.8 | Biochemical results
In the DOX group compared to all groups, MDA levels were statistically significantly enhanced, while the activities of SOD and GPx enzymes were statistically significantly diminished (p < .05). In the DOX + ALA group compared to the DOX group, MDA levels were significantly re-duced while the activities of SOD and GPx enzymes were statistically significantly increased ( p < .05) (Table 5). Thus, ALA administration reduced the DOX-induced oxidative stress by decreasing testicular MDA levels and increasing antioxidant enzyme activities (SOD, GPx).
Serum testosterone levels were significantly lower in the DOX group compared to other treatment groups (respectively; 3.85 ± 0.28, 2.04 ± 0.52, 2.61 ± 0.43, 3.97 ± 0.11) (p < .05). In contrast, the levels of testosterone were significantly high in the DOX + ALA compared to the DOX group (p < .05) (Table 5).
4 | DISCUSSION
The male reproductive system is one of the serious targets of cy-totoxic chemotherapy (Prahalathan et al., 2005). DOX, one of the F I G U R E 1 Photomicrographs of histopathological analyses and TUNEL staining. A: Histopathology of the testes with Haematoxylin & Eosin stain; in the control group (a), the germinal epithelium (GE) in the seminiferous tubules and spermatozoa (star) in the lumen were in normal histological appearance. In the DOX group (b), tubule consisting of only a few spermatogonia (triangle), atrophic tubule (thick arrow), germinal epithelial cells shedding into the lumen (thin arrow), degeneration in seminiferous tubule germinative epithelium (broken arrow), absence of spermatozoa in tubule lumens (star) were observed. In the DOX + ALA group (c), mild vacuolisation (thick arrow) and mild vascular congestion in the interstitial area (thin arrow) were observed in some seminiferous tubules. In the ALA group (d), testis tissue showed normal morphology. Scale bar:100 µm, ×200. Results of TUNEL staining; arrows indicate TUNEL positive cells labelled as brown nuclei of the groups (e; control, f; DOX; g; DOX + ALA, h; ALA). TUNEL positive cells significantly increased in the DOX group compared to all groups (p < .05). Compared to the DOX group, TUNEL positive cells were significantly reduced in the DOX + ALA group (p < .05). All slides were counterstained with haematoxylin, scale bar:100 µm, ×200. B: Results of apoptotic index of all groups. ap < .005 versus Control
chemotherapeutic drugs, is an anthracycline group antibiotic used in the treatment of many types of cancer and has serious side ef-fects on the testis (Yeh et al., 2009). Studies in rodents showed that DOX impairs male reproductive function by adversely affecting spermatogenesis and testicular function (Atessahin et al., 2006; Yeh et al., 2009). Because of the serious toxic effects of DOX on fertility,
it would be beneficial to use it simultaneously with therapeutic agents to alleviate the side effects. This study provides evidence that co-treatment with ALA could effectively mitigate DOX-induced testicular toxicity.
The exact mechanism of testicular toxicity caused by DOX is still unclear, but ROS production is blamed. ROS is necessary for F I G U R E 2 Immunoreactivities of MFN2 and CASP3 in testes. (a) Immunohistochemical images of testis tissues for MFN2 and CASP3. MFN2 immunostaining (a; control, b; DOX; c; DOX + ALA, d; ALA); thick black arrow indicates spermatocyte, round and elongated spermatid, thin black arrow indicated Leydig cells immunoreactive areas. Compared to all groups, MFN2 immunoreactivity significantly decreased in the DOX group (p < .05). In the DOX + ALA, MFN2 immunoreactivity significantly increased compared to the DOX groups (p < .05). CASP3 immunostaining (e; control, f; DOX; g; DOX + ALA, h; ALA); weak staining in the control and ALA groups. Intense staining in DOX administered group. Moderate staining in DOX + ALA-treated group. All slides were counterstained with haematoxylin, scale bar: 100 μm, ×200. (b) Histoscores of MFN2 and CASP3 immunoreactivities. ap < .005 versus Control group. bp < .005 versus DOX group
F I G U R E 3 Effects of doxorubicin and/ or alpha-lipoic acid treatments on mRNA and miRNA expressions of rat testis tissue samples. *Significant at (p < .05). a means that a significant change (p < .05) occurred in expression levels compared to the control group. b means that a significant change (p < .05) occurred in expression levels compared to the DOX group. c means that a significant change (p < .05) occurred in expression levels compared to DOX + ALA group
the physiological conditions of the male reproductive system, but excessive ROS production leads to lipid peroxidation and oxidative stress. SOD and GPx are endogenous antioxidants that protect cells from oxidative damage by eliminating ROS (Ceribasi et al., 2012). In our study, levels of MDA were higher in the DOX group compared to all groups, while SOD and GPx activities were lower. Our data were consistent with the conclusion of other investigators (Uygur et al., 2014; Yeh et al., 2009). Taken together, DOX exposure increased ox-idative stress associated with an antioxidant system that was wors-ened by a strong decrease in both SOD and GPx activities in testis. Therefore, spermatogenesis was disrupted. The mitigation of prob-lems related to reduced antioxidant parameters and increased lipid peroxidation after the administration of ALA demonstrates that ALA improves spermatogenesis by eliminating oxidative stress.
DOX-induced oxidative stress in testicular tissue causes DNA fractures and damage, leading cell death in spermatogonia and spermatocytes undergoing meiotic division (Türedi et al., 2015; Yeh et al., 2009). Apoptosis is a programmed cell death process that can be accomplished in a mitochondria-dependent or mitochondria-in-dependent way. DOX is a well-known pro-apoptotic agent and can induce apoptosis of testicular germ cells by stimulating the mito-chondria-dependent pathway (Yeh et al., 2007). In our study, the apoptotic index increased significantly in the DOX-treated group compared to all groups. This result is compatible with previous find-ings (Uygur et al., 2014; Yeh et al., 2007, 2009). CASP3, one of the important mediators of mitochondrial apoptosis, is a protease that catalyses the specific cleavage of many cellular proteins (Porter& & JaÈ nicke1, 1999). However, caspase-dependent apoptosis is linked to activation of the Tp53. Tp53 is a well-known tumour suppres-sor protein and also involved in the processes of apoptosis (Chen et al., 2009). Yeh et al. (2007) have been shown that activation of the mitochondrial Tp53 pathway involved in DOX-induced testicular germ cell loss (Yeh et al., 2007). Consistently, we found high levels of Tp53 mRNA in DOX-treated testicular tissues and we thought that this may be related to increased CASP3 activation. Recent studies have reported that increased Tp53 affects BAX and BCL2 expression levels (Das et al., 2012; Lahoti et al., 2012). After DOX administration, the increase in the expression of BAX mRNA, which is the pro-apoptotic marker, and the decrease in the expression of BLC-2, which is the anti-apoptotic marker, support previous studies.
ALA treatment improved the apoptotic changes in testicular tissue by reducing TUNEL positive cell number and Tp53, CASP3 and BAX expressions.
miRNAs mainly regulate physiological and pathophysiological processes such as cell proliferation, differentiation, apoptosis, in-cluding reproduction (Hammond, 2006). Abnormal expression of miRNAs can affect spermatogenesis, causing infertility (Khawar et al., 2019). However, the physiological roles of these testicular miRNAs remain largely unknown. Tp53 is a target of miR-449a-5p and miR-92 (Neveu et al., 2010). We therefore hypothesised that Tp53 participating in the cellular response to oxidative stress might be critical downstream targets of miR-449a-5p and miR-92. In our study, it was found that testicular miR-449a-5p expression reduced in the DOX group compared to the control. However, we found that increase of this miRNA decreased Tp53 levels in the DOX + ALA. These results are evidence that miR-449-5p inhibits the expression of the target Tp53 gene by degradation or suppressing its mRNA. Besides, the significant increase of miR-92 in the ALA group com-pared to DOX and DOX + ALA groups revealed that miR-92 sup-pressed Tp53 gene expression. These data suggest that miR-449a-5p and miR-92 are important component of the Tp53 tumour suppres-sor network. Also, our results showed that spermatogenic germ cell loss can be prevented by inhibiting Tp53-mediated apoptosis regu-lated with these miRNAs.
In our study, significantly lower body and relative testicular weights were observed in rats treated with DOX compared to other groups, as described in other experimental studies administering doxorubicin alone (Patil & Balaraman, 2009; Türedi et al., 2015). Since testicular weight depends on the mass of seminiferous tubule germ cells, the reduction in testicular weight can be explained by the degenerative properties of the affected tubules and germ cells in doxorubicin-treated rats (Katoh et al., 2002). Morphometric pa-rameters (STD and GET) and germ cell numbers ensure more knowl-edge about the result of germ cell degeneration arise from testicular injury (Katoh et al., 2002; Vendramini et al., 2010). Consistent with these reports, our results demonstrated that the prominent reduc-tion in morphometric parameters and consequence a decreased testicular weight in rats treated with doxorubicin was due to germ cell loss. Our findings were supported by other studies (Nowrouzi et al., 2019; Türedi et al., 2015). ALA administrations proved the
Parameters Control DOX DOX + ALA ALA
MDA (nmol/g
protein) 16.92 ± 1.34 33.15 ± 3.74
a 21.42 ± 1.93a,b 17.69 ± 0.74b
SOD (U/g protein) 115.82 ± 4.26 60.52 ± 9.91a 95.82 ± 7.92a,b 119.02 ± 5.82b
GPx (U/g protein) 20.09 ± 099 15.82 ± 0.75a 17.70 ± 0.55a,b 20.60 ± 1.35b
Testosterone (ng/ml) 3.85 ± 0.28 2.04 ± 0.52a 2.61 ± 0.43a,b 3.97 ± 0.11b
Note: Values are given as mean ± standard deviation.
Abbreviations: GSH-Px, glutathione peroxidase; MDA, malondialdehyde; SOD, superoxide dismutase.
aWhen compared to control group, bWhen compared to DOX group (p < .05).
TA B L E 5 Results of biochemical analysis of all groups
body and relative testis weight and morphometric parameters in the DOX + ALA group. We think that these results are related to the decreased number of apoptotic cells in the seminiferous tubules ob-served in the DOX + ALA group with ALA treatment.
Histopathologically, our study showed that 15 mg/kg DOX led to disrupting seminiferous tubule structure, decrease in the spermato-genic cell series, atrophic tubules, degeneration in seminiferous tu-bule germinative epithelium and immature cell debris in tutu-bule lumen. It also caused a reduced JMTBS. Previous studies were consistent with these results (Aksu et al., 2019; Uygur et al., 2014). These his-topathological damages in testicular tissues induced with DOX may have caused the impairment of spermatogenesis. Decrease in STD and GET and reduced relative testicular weights in the DOX group support germ cell loss. On the other hand, ALA treatment decreased the intensity of DOX-induced histopathological changes. Thus, the ameliorating effects of ALA on DOX-induced testicular toxicity were histopathologically confirmed as shown in previous studies (Lebda et al., 2014; Pınar et al., 2018).
Testosterone is a necessary hormone for the maintenance of spermatogenesis, germ cell growth and seminiferous tubule mor-phology in the testis (Salihu et al., 2017). DOX administration has been reported to reduce testosterone levels in studies with rats and mice (Belhan et al., 2020; Nowrouzi et al., 2019). Consistently, in our study, it was determined that serum testosterone levels de-creased significantly with DOX treatment. This may be due to the devastating impact of DOX on Leydig cells. Since testosterone is the essential regulative hormone of spermatogenesis, DOX-induced seminiferous tubule cell degeneration may be attributed to a low serum testosterone concentration. In addition, decreasing testos-terone levels likely concerned with the reduction in the number of Leydig cells in testis tissue. The increasing number of TUNEL posi-tive cells and intense CASP3 immunoreactivities in Leydig cells con-firms these data. Current studies have shown that ALA treatment improves Leydig cell testosterone production (Lebda et al., 2014; Othman et al., 2012). Likewise, our study found that the ALA ad-ministration could ameliorate the testosterone levels. This might be one of the potential protective mechanisms against testicular dam-age in DOX-treated rats. We can say that one of these potential protection mechanisms is provided by decreased Leydig cell death with ALA treatment.
Previous studies have reported mitochondria are important in spermatogenesis, energy for sperm motility, sperm maturation and fertility (Singh et al., 2010). Therefore, typical mitochondrial func-tion is a key for remaining normal sperm funcfunc-tion and male fertil-ity. DOX-induced cellular dysfunction is associated with disrupted balance between mitochondrial fusion and fission mechanisms that are essential for health of cell and mitochondrial function (Marechal et al., 2011). MFN2, the fusion protein, is essential for the main-tenance of spermatogonial differentiation and spermatogenesis (Migliaccio et al., 2019). It has been demonstrated that ROS pro-duction increased in MFN2 deficiency (Munoz et al., 2013). MFN2 deficiency leads to mitochondrial fragmentation and cell death, while MFN2 overexpression has an anti-apoptotic role (Jahani-Asl
et al., 2007). Further, it has been reported that a connection exists between mitofusins (Mfn1 and Mfn2) and the pro-apoptotic mem-bers of the Bcl-2 family, Bax and Bak (Brooks et al., 2007). However, the relationship between MFN2 and apoptosis in DOX-induced testicular injury is not available in the literature. In our study, sup-porting these data, we found that the expression of MFN2 in the seminiferous tubules and Leydig cells decreased in the DOX group and the BAX / BCL2 mRNA ratio, CASP3 expression levels, apop-totic index increased in the testicular tissue. These findings indi-cated that DOX restricted mitochondrial fusion by reducing MFN2 expression and the disturbed spermatogenesis upon MFN2 defi-ciency is presumably due to increased apoptosis in seminiferous tubule germ cells and Leydig cells. In a recent study, it has been reported that mitochondrial fusion has an important role in steroid production. According to the study, MFN2 expression increased immediately after hormone stimulation and MFN2 destruction was sufficient to disrupt steroid biosynthesis (Duarte et al., 2012). Based on this potential relationship between steroidogenesis and MFN2, in our study, decreasing levels of testosterone hormone with decreased MFN2 immunoreactivity in Leydig cells in the DOX group suggested that MFN2 may be related to steroid hormone synthesis in Leydig cells. Experiments in rodents have suggested that ALA treatment promotes mitochondrial biogenesis in different metabolic tissues and is effective in the expression of mitochondrial genes by reducing oxidative stress (Aliev et al., 2009; Valdecantos et al., 2012). However, there is no literature available on the effects of ALA on MFN2 involved in mitochondrial biogenesis in the rat tes-tis in DOX-induced testicular injury. In our study, in the DOX + ALA group compared to the DOX group, MFN2 expressions that showed with immunohistochemical and RT-PCR analysis increased with ALA treatment in testis tissue. Also, we found that ALA treatment contributed to serum testosterone levels by increasing MFN2 expression levels in Leydig cells. Taken together, the decrease in the number of TUNEL positive cells and the increase in MFN2 ex-pressions in the DOX + ALA group compared to the DOX group suggested that ALA could improve cell death by affecting MFN2 expressions thereby contribute to spermatogenesis.
5 | CONCLUSION
In conclusion, the present study indicated that DOX negatively af-fects male fertility by apoptotic cell death, disrupting mitochondrial fusion, increasing oxidative stress, decreasing testosterone hormone levels and impairing testicular histology. However, ALA treatment could be a potent strategy to alleviate DOX-induced testicular dam-age by inhibiting these detriment mechanisms. We think that the underlying causes of these protection mechanisms can be inducing antioxidant signalling pathways, improving mitochondrial fusion, in-hibiting apoptotic signal and reducing oxidative stress. Accomplished identification of interventions that could lessen DOX-induced tes-ticular toxicity would be of great clinical advantage for cancer pa-tients treated with DOX.
ACKNOWLEDGEMENTS
This study was supported by the Mardin Artuklu University Scientific Research Projects Management Unit, Mardin, TURKEY, [Project number M. A.Ü.BAP. 18.SYO.010]. Author elects to not share data. CONFLIC T OF INTEREST
The authors declare that they have no competing interests. DATA AVAIL ABILIT Y STATEMENT
Data available on request from the authors. ORCID
Elif Erdem Guzel https://orcid.org/0000-0002-2097-7818
Nalan Kaya Tektemur http://orcid.org/0000-0001-8880-4932
Ahmet Tektemur https://orcid.org/0000-0002-2476-0413
REFERENCES
Aksu, E. H., Kandemir, F. M., Yıldırım, S., Küçükler, S., Dörtbudak, M. B., Çağlayan, C., & Benzer, F. (2019). Palliative effect of curcumin on doxorubicin-induced testicular damage in male rats. Journal of Biochemical and Molecular Toxicology, 33(10), e22384. https://doi. org/10.1002/jbt.22384
Aliev, G., Liu, J., Shenk, J. C., Fischbach, K., Pacheco, G. J., Chen, S. G., Obrenovich, M. E., Ward, W. F., Richardson, A. G., Smith, M. A., Gasimov, E., Perry, G., & Ames, B. N. (2009). Neuronal mitochondrial amelioration by feeding acetyl-L-carnitine and lipoic acid to aged rats. Journal of Cellular and Molecular Medicine, 13, 320–333. https:// doi.org/10.1111/j.1582-4934.2008.00324.x
Atessahin, A., Urk, G., Karahan, I., Yilmaz, S., Ceribasi, A., & Bulmus, O. (2006). Lycopene prevents adriamycin-induced testicular tox-icity in rats. Fertility and Sterility, 85(1), 1216–1222. https://doi. org/10.1016/j.fertn stert.2005.11.035
Ayla, S., Seckin, I., Tanriverdi, G., Cengiz, M., Eser, M., Soner, B. C., & Oktem, G. (2011). Doxorubicin induced nephrotoxicity: Protective effect of nicotinamide. International Journal of Biochemistry & Cell Biology, 2011, 1–9. https://doi.org/10.1155/2011/390238 Belhan, S., Özkaraca, M., Özdek, U., & Kömüroğlu, A. U. (2020).
Protective role of chrysin on doxorubicin-induced oxidative stress and DNA damage in rat testes. Andrologia, 52(9), e13747. https://doi. org/10.1111/and.13747
Brooks, C., Wei, Q., Feng, L., Dong, G., Tao, Y., Mei, L., Xie, Z.-J., & Dong, Z. (2007). Bak regulates mitochondrial morphology and pathology during apoptosis by interacting with mitofusins. Proceedings of the National Academy of Sciences, 104(28), 11649–11654. https://doi. org/10.1073/pnas.07039 76104
Ceribasi, A. O., Sakin, F., Türk, G., Sönmez, M., & Atessahin, A. (2012). Impact of ellagic acid on adriamycin-induced testicular histopatho-logical lesions, apoptosis, lipid peroxidation and sperm damages. Experimental and Toxicologic Pathology, 64, 717–724. https://doi. org/10.1016/j.etp.2011.01.006
Chen, J., Ng, S. M., Chang, C., Zhang, Z., Bourdon, J. C., Lane, D. P., & Peng, J. (2009). p53 isoform delta113p53 is a p53 target gene that antago-nizes p53 apoptotic activity via BclxL activation in zebrafish. Genes & Development, 23, 278–290. https://doi.org/10.1101/gad.1761609 Chen, W., Sun, Y., Sun, Q. I., Zhang, J., Jiang, M., Chang, C., Huang, X.,
Wang, C., Wang, P., Zhang, Z., Chen, X., & Wang, Y. (2020). MFN2 plays a distinct role from mfn1 in regulating spermatogonial differ-entiation. Stem Cell Reports, 14(5), 1–15. https://doi.org/10.1016/j. stemcr.2020.03.024
Das, J., Ghosh, J., Manna, P., & Sil, P. C. (2012). Taurine protects rat tes-tes against doxorubicin-induced oxidative stress as well as p53, Fas
and caspase 12-mediated apoptosis. Amino Acids, 42(5), 1839–1855. https://doi.org/10.1007/s0072 6-011-0904-4
Deshpande, K. C., Kulkarni, M. M., & Rajput, D. V. (2018). Evaluation of glutathione peroxidase in the blood and tumor tissue of oral squa-mous cell carcinoma patients. Journal of Oral and Maxillo Facial Pathology, 22(3), 447. https://doi.org/10.1007/s1266 3-009-0066-z Duarte, A., Poderoso, C., Cooke, M., Soria, G., Maciel, F. C., Gottifredi, V.,
& Podestá, E. J. (2012). Mitochondrial fusion is essential for steroid biosynthesis. PLoS One, 7(9), e45829. https://doi.org/10.1371/journ al.pone
El-sayed, E. M., Mansour, A. M., & El-sawy, W. S. (2017). Alpha lipoic acid prevents doxorubicin-induced nephrotoxicity by mitigation of oxida-tive stress, inflammation, and apoptosis in rats. Journal of Biochemical and Molecular Toxicology, 31(9), e21940. https://doi.org/10.1002/ jbt.21940
Gharanei, M., Hussain, A., Janneh, O., & Maddock, H. L. (2013). Doxorubicin induced myocardial injury is exacerbated following isch-aemic stress via opening of the mitochondrial permeability transition pore. Toxicology and Applied Pharmacology, 268(2), 149–156. https:// doi.org/10.1016/j.taap.2012.12.003
Gorini, S., De Angelis, A., Berrino, L., Malara, N., Rosano, G., & Ferraro, E. (2018). Chemotherapeutic drugs and mitochondrial dysfunction: Focus on doxorubicin, trastuzumab, and sunitinib. Oxidative Medicine and Cellular Longevity, 2018, 1–15, https://doi. org/10.1155/2018/7582730
Hammond, S. M. (2006). RNAi, microRNAs, and human disease. Cancer Chemotherapy and Pharmacology, 58(1), 63–68. https://doi. org/10.1007/s0028 0-006-0318-2
Jahani-Asl, A., Cheung, E. C., Neuspiel, M., MacLaurin, J. G., Fortin, A., Park, D. S., McBride, H. M., & Slack, R. S. (2007). Mitofusin 2 protects cerebellar granule neurons against injury-induced cell death. Journal of Biological Chemistry, 282, 23788–23798. https://doi.org/10.1074/ jbc.M7038 12200
Johnsen, S. G. (1970). Testicular biopsy score count – a method for reg-istration of spermatogenesis in human testes: Normal values and results in 335 hypogonadal males. Hormones, 1(1), 2–25. https://doi. org/10.1159/00017 8170
Karaguzel, E., Kutlu, O., Yulug, E., Mungan, S., Kazaz, I. O., & Tok, D. S. (2012). Comparison of th eprotective effect of dipyrida-mole and acetyl salicylic acid on long-term histologic damage in a rat model of testicular ischemia–reperfusion injury. Journal of Pediatric Surgery, 47, 1716–1723. https://doi.org/10.1016/j.jpeds urg.2012.01.078
Katoh, C., Kitajima, S., Saga, Y., Kanno, J., Horii, I., & Inoue, T. (2002). Assessment of quantitative dual-parameter flow cytometric analysis for the evaluation of testicular toxicity using cyclophosphamide- and ethinylestradiol treated rats. The Journal of Toxicological Sciences, 27(2), 87–96. https://doi.org/10.2131/jts.27.87
Khawar, M. B., Mehmood, R., & Roohi, N. (2019). MicroRNAs: Recent insights towards their role in male infertility and reproductive can-cers. Bosnian Journal of Basic Medical Sciences, 19(1), 31. https://doi. org/10.17305/ bjbms.2018.3477
Lahoti, T., Patel, D., Thekkemadom, V., Beckett, R., & Ray, S. D. (2012). Doxorubicin-induced in vivo nephrotoxicity involves oxidative stress-mediated multiple pro- and anti-apoptotic signaling path-ways. Current Neurovascular Research, 9(4), 282–295. https://doi. org/10.2174/15672 02128 03530636
Lebda, M., Gad, S., & Gaafar, H. (2014). Effects of lipoic acid on acryl-amide induced testicular damage. Materia Socio Medica, 26(3), 208. https://doi.org/10.5455/msm.2014.26.208-212
Marechal, X., Montaigne, D., Marciniak, C., Marchetti, P., Hassoun, S., Beauvillain, J., Lancel, S., & Neviere, R.(2011). Doxorubicin-induced cardiac dysfunction is attenuated by ciclosporin treatment in mice through improvements in mitochondrial bioenergetics. Clinical Science, 121, 405–413. https://doi.org/10.1042/CS201 10069
Migliaccio, V., Sica, R., Di Gregorio, I., Putti, R., & Lionetti, L. (2019). High-fish oil and high-lard diets differently affect testicular antioxi-dant defense and mitochondrial fusion/fission balance in male wistar rats: Potential protective effect of ω3 polyunsaturated fatty acids targeting mitochondria dynamics. International Journal of Molecular Sciences, 20(12), 3110. https://doi.org/10.3390/ijms2 0123110 Muñoz, J. P., Ivanova, S., Sánchez-Wandelmer, J., Martínez-Cristóbal, P.,
Noguera, E., Sancho, A., Díaz-Ramos, A., Hernández-Alvarez, M. I., Sebastián, D., Mauvezin, C., Palacín, M., & Zorzano, A.(2013). Mfn2 modulates the UPR and mitochondrial function via repression of PERK. The EMBO Journal, 32, 2348–2361. https://doi.org/10.1038/ emboj.2013.168
Neveu, P., Kye, M. J., Qi, S., Buchholz, D. E., Clegg, D. O., Sahin, M., Park, I.-H., Kim, K.-S., Daley, G. Q., Kornblum, H. I., Shraiman, B. I., & Kosik, K. S. (2010). MicroRNA profiling reveals two distinct p53-related human pluripotent stem cell states. Cell Stem Cell, 7(6), 671–681. https://doi.org/10.1016/j.stem.2010.11.012
Nowrouzi, F., Azadbakht, M., Kalehoei, E., & Modarresi, M. (2019). Protective effect of rosa canina extract against doxorubicin-induced testicular toxicity in mice. Brazilian Archives of Biology and Technology, 62(12), e19180017. https://doi.org/10.1590/1678-4324-20191 80017 Ohkawa, H., Ohishi, N., & Yagi, K. (1979). Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Analytical Biochemistry, 95, 351–358. https://doi.org/10.1016/0003-2697(79)90738 -3 Othman, A. I., El-Missiry, M. A., Koriem, K. M., & El-Sayed, A. A. (2012).
Alfa-Lipoic acid protects testosterone secretion pathway and sperm quality against 4-tert-octylphenol induced reproductive toxic-ity. Ecotoxicology and Environmental Safety, 81, 76–83. https://doi. org/10.1016/j.ecoenv.2012.04.018
Öztürk, E., Kaymak, E., Akin, A. T., Karabulut, D., Ünsal, H. M., & Yakan, B. (2020). Thymoquinone is a protective agent that reduces the negative effects of doxorubicin in rat testis. Human & Experimental Toxicology, 39(10), 1364–1373. https://doi.org/10.1177/09603 27120 924108 Patil, L., & Balaraman, R. (2009). Effect of melatonin on doxorubicin
in-duced testicular damage in rats. International Journal of PharmTech Research, 1(3), 879–884.
Pınar, N., Çakırca, G., Özgür, T., & Kaplan, M. (2018). The protective ef-fects of alpha lipoic acid on methotrexate induced testis injury in rats. Biomedicine & Pharmacotherapy, 97, 1486–1492. https://doi. org/10.1016/j.biopha.2017.11.078
Porter, A. G., & JaÈ nicke, R. U.(1999). Emerging roles of caspase-3 in apoptosis. Cell Death and Differentiation, 6, 99–104. https://doi. org/10.1038/sj.cdd.4400476
Prahalathan, C., Selvakumar, E., & Varalakshmi, P. (2005). Protective effect of lipoic acid on adriamycin-induced testicular toxicity. Clinica Chimica Acta, 360(1–2), 160–166. https://doi.org/10.1016/j.cccn.2005.04.025 Prahalathan, C., Selvakumar, E., & Varalakshmi, P. (2006). Modulatory
role of lipoic acid on adriamycin-induced testicular injury. Chemico-Biological Interactions, 160(2), 108–114. https://doi.org/10.1016/j. cbi.2005.12.007
Salihu, M., Ajayi, B. O., Adedara, I. A., & Farombi, E. O. (2017). 6-Gingerolrich fraction prevents disruption of histomorphometry
and marker enzymes of testicular function in carbendazim-treated rats. Andrologia, 49(10), e12782–https://doi.org/10.1111/and.12782 Selvakumar, E., Prahalathan, C., Mythili, Y., & Varalakshmi, P. (2004).
Protective effect of DL-α-lipoic acid in cyclophosphamide induced oxidative injury in rat testis. Reproductive Toxicology, 19(2), 163–167. https://pubmed.ncbi.nlm.nih.gov/15501 381/.
Singh, R., Rahul, P., & Mahdi, A. A. (2010). Mitochondria, spermatogen-esis and male infertility. Mitochondrion, 10(5), 419–428. https://doi. org/10.1016/j.mito.2010.05.015
Sun, Y., Oberley, L. W., & Li, Y. (1988). A simple method for clinical assay of superoxide dismutase. Clinical Chemistry, 34(3), 497–500. https:// doi.org/10.1093/clinc hem/34.3.497
Türedi, S., Yuluğ, E., Alver, A., Kutlu, Ö., & Kahraman, C. (2015). Effects of resveratrol on doxorubicin induced testicular damage in rats. Experimental and Toxicologic Pathology, 67(3), 229–235. https://doi. org/10.1016/j.etp.2014.12.002
Uygur, R., Aktas, C., Tulubas, F., Uygur, E., Kanter, M., Erboga, M., & Ozen, O. A. (2014). Protective effects of fish omega-3 fatty acids on doxo-rubicin-induced testicular apoptosis and oxidative damage in rats. Andrologia, 46(8), 917–926. https://doi.org/10.1111/and.12173 Valdecantos, M. P., Perez-Matute, P., Gonzalez-Muniesa, P.,
Prieto-Hontoria, P. L., Moreno-Aliaga, M. J., & Martinez, J. A. (2012). Lipoic acid improves mitochondrial function in nonalcoholic steatosis through the stimulation of sirtuin 1 and sirtuin 3. Obesity, 20, 1974– 1983. https://doi.org/10.1038/oby.2012.32
Vendramini, V., Sasso-Cerri, E., & Miraglia, S. M. (2010). Amifostine reduces the seminiferous epithelium damage in doxorubi-cin-treated prepubertal rats without improving the fertility sta-tus. Reproductive Biology and Endocrinology, 8(3), https://doi. org/10.1186/1477-7827-8-3
Yeh, Y. C., Lai, H. C., Ting, C. T., Lee, W. L., Wang, L. C., Wang, K. Y., & Liu, T. J. (2007). Protection by doxycycline against doxorubicinin-duced oxidative stress and apoptosis in mouse testes. Biochemical Pharmacology, 74(7), 969–980. https://doi.org/10.1016/j. bcp.2007.06.031
Yeh, Y. C., Liu, T. J., Wang, L. C., Lee, H. W., Ting, C. T., Hung, C. J., Wang, K. Y., & Lai, H. C.(2009). A standardized extract of Ginkgo biloba suppresses doxorubicin-induced oxidative stress and p53-mediated mitochondrial apoptosis in rat tes-tes. British Journal of Pharmacology, 156(1), 48–61. https://doi. org/10.1111/j.1476-5381.2008.00042.x
How to cite this article: Erdem Guzel E, Kaya Tektemur N, Tektemur A. Alpha-lipoic acid may ameliorate testicular damage by targeting dox-induced altered antioxidant parameters, mitofusin-2 and apoptotic gene expression.
Andrologia. 2021;53:e13990. https://doi.org/10.1111/
and.13990
View publication stats View publication stats
