Full Terms & Conditions of access and use can be found at
https://www.tandfonline.com/action/journalInformation?journalCode=iphb20
Pharmaceutical Biology
ISSN: 1388-0209 (Print) 1744-5116 (Online) Journal homepage: https://www.tandfonline.com/loi/iphb20
Resveratrol regulates oxidative biomarkers
and antioxidant enzymes in the brain of
streptozotocin-induced diabetic rats
Gökhan Sadi & Dilan Konat
To cite this article: Gökhan Sadi & Dilan Konat (2016) Resveratrol regulates oxidative biomarkers and antioxidant enzymes in the brain of streptozotocin-induced diabetic rats, Pharmaceutical Biology, 54:7, 1156-1163, DOI: 10.3109/13880209.2015.1056311
To link to this article: https://doi.org/10.3109/13880209.2015.1056311
Published online: 16 Jun 2015.
Submit your article to this journal
Article views: 1409
View related articles
View Crossmark data
ISSN 1388-0209 print/ISSN 1744-5116 online Editor-in-Chief: John M. Pezzuto
Pharm Biol, 2016; 54(7): 1156–1163
!2015 Informa Healthcare USA, Inc. DOI: 10.3109/13880209.2015.1056311
ORIG INAL AR TICLE
Resveratrol regulates oxidative biomarkers and antioxidant enzymes
in the brain of streptozotocin-induced diabetic rats
Go¨khan Sadi and Dilan Konat
Department of Biology, Karamanoglu Mehmetbey University, Karaman, Turkey
Abstract
Context: Oxidative stress has been implicated in the progression of pathogenesis in diabetes mellitus and leads to a variety of deformations in the central nervous system. Recent studies have provided several insights on therapeutic uses of resveratrol in diabetic complications. Objective: The present study determines if resveratrol ameliorates oxidative stress and molecular changes in the brain frontal cortex of streptozotocin-induced diabetic rats. Materials and methods: Rats were divided into four groups: control, diabetic, resveratrol-treated control, and resveratrol-treated diabetic. After diabetes induction, resveratrol (20 mg/kg) was given intraperitoneally once daily for 4 weeks. In addition to enzymatic activities, gene and protein expression of brain antioxidant enzymes were utilized by qRT-PCR and Western blot, respectively.
Results: The results indicated a significant elevation in total oxidant species (1.22-fold) and malonedialdehyde (1.38-fold) contents in diabetic rat brain cortex tissues. In addition, significant augmentation in the activities of catalase (1.38-fold) and superoxide dismutase (3-fold) was witnessed with the gene and protein expression levels reflecting a transcriptional regulation. Resveratrol treatment significantly normalized diabetic malonedialdehyde and oxidized glutathione levels and strengthens the action of all antioxidant enzymes. Recovery of the diabetes-associated changes reflects the reduction of oxidative conditions by resveratrol and reveals the decrease in the requirement for the activation of antioxidant defense systems in the brain tissues of diabetic rats.
Discussion and conclusion: Potent antioxidant and neuroprotective properties of resveratrol against diabetes-induced oxidative damage were demonstrated and the results support the conduct of new studies searching for the molecular mechanism of diabetes-induced changes in brain tissues.
Keywords
Brain, diabetes mellitus, gene expression, oxidative stress, resveratrol
History
Received 28 February 2015 Revised 29 April 2015 Accepted 26 May 2015 Published online 16 June 2015
Introduction
Diabetes mellitus is a systemic disorder which affects carbohydrate, protein, and lipid metabolism due to reduced insulin secretion or its decreased action on cells. Diminished insulin secretion and/or presence of insulin resistance are the hallmarks of diabetes and might lead to dysfunction and inflammation in variety of tissues including central nervous system elements (Skov et al., 2012; Thomas et al., 2013).
There is considerable evidence that hyperglycemia results in the production of reactive oxygen species, which mediate oxidative stress in various tissues and, importantly, exerts damaging effects on all cellular biomolecules. In fact, there are enzymatic and non-enzymatic protective mechanisms against oxidative stress. The major antioxidant enzymes are super-oxide dismutase (SOD) isozymes, SOD-1 and SOD-2, which neutralize superoxide radicals in cytoplasm and mitochondria,
respectively. Other protective mechanisms against oxidative stress could be classified as glutathione S-transferases (GSTs), which catalyze the conjugation of glutathione to a wide range of electrophiles and catalases (CAT) which catalyzes the decomposition of hydrogen peroxide to water, a function that is shared with glutathione peroxidase (GPx).
When neural cells are under oxidative stress, excessive reactive oxygen species are produced that may induce neuronal death leading to the destruction of both neuronal and vascular cells in the central nervous system. Recently, it has been shown that diabetes has negative effects on brain functions. Enhancement in hippocampal astrocytic reactivity, impaired synaptic plasticity, vascular changes, decreased dendritic complexity and morphology, and disturbed neuro-transmission have detrimental effects on diabetic brain tissues (Ceretta et al., 2012; Jing et al., 2013; Thomas et al., 2013). Such significant functional and morphological changes have been correlated well with the alterations in memory and learning abilities (El-Akabawy & El-Kholy, 2014).
A plant-derived polyphenol, trans-resveratrol (3,5,40 -trihy-droxystilbene), exhibits a wide range of biological properties,
Correspondence: Go¨khan Sadi, Department of Biology, Karamanoglu Mehmetbey University, 70100 Karaman, Turkey. Tel: +90 338 2262115/ 3824. Fax: +90 338 2262116. E-mail: [email protected], sadi.gokhan@ gmail.com
and its antioxidant properties have been previously shown in the prevention and treatment of diabetic complications (Pandey, 2009; Szkudelski & Szkudelska, 2011). Several lines of evidence also demonstrated its inflammatory, anti-aggregation, and neuroprotective properties (Jing et al., 2013; Marques et al., 2009; Pandey, 2009). Recently, it has become increasingly attractive as a therapeutic agent in the treatment of a variety of pathologies, including diabetes mellitus (Szkudelska & Szkudelski, 2010). Potent neuroprotective action of resveratrol against diabetic oxidative damage has been confirmed since resveratrol was found to reduce the levels of oxidative stress markers and elevated tissue gluta-thione contents in diabetic rat brain tissues as compared with the streptozotocin-induced diabetic-untreated group (Ates et al., 2007; Prabhakar, 2013). However, the mechanisms underlying the beneficial effects of resveratrol have not been completely elucidated, although its antioxidant activ-ity has been demonstrated to protect tissues caused by oxidative stress (Marques et al., 2009; Thirunavukkarasu et al., 2007).
In order to explore brain-specific molecular alterations in diabetes and in vivo effects of resveratrol, we hypothesized that diabetes-related alterations in neuronal dysfunctions could be casually returned to normal values with resveratrol. To investigate the molecular changes in brain functions caused by diabetes-induced oxidative changes, this study was designed to demonstrate how antioxidant enzyme status was regulated in the brain tissues at the gene, protein, and activity levels and how resveratrol mediates these alterations in rat models.
Materials and methods
Animals and treatment procedure
The animal protocols were confirmed by the Ethical Animal Research Committee of Karamanoglu Mehmetbey University (K.M.U. ET-11/01-02). This study was carried out strictly according to rules of the Guide for the Care and Use of Laboratory Animals as published by the US National Institute of Health (NIH Publication no. 85/23, revised in 1986). Eight-week-old male Wistar rats were housed under temperature-controlled rooms (20–22C) with a 12 h light-dark cycle. The animals were fed with standard rodent diet composed of 62% starch, 23% protein, 4% fat, 7% cellulose, standard vitamins, and salt mixture (chow pellet). After acclimation for 1 week, animals were randomly assigned into four groups: (1) control group (n¼ 12) injected only vehicle; 10% dimethyl sulfoxide (DMSO) for 4 weeks, (2) resveratrol group (C+RSV, n¼ 12) which were given a daily intraperitoneal dose of 20 mg/kg/day resveratrol in vehicle throughout the 4-week period, (3) diabetes group (n¼ 12) received single dose of STZ (55 mg/ kg) dissolved in 0.05 M citrate buffer (pH: 4.5) and daily vehicle for 4 weeks, (4) resveratrol treated diabetic group (D+RSV) (n¼ 9) which received a daily intraperitoneal dose of 20 mg/kg/d resveratrol throughout the 4-week period, starting from 2 d after STZ administration. At the end of the study period, all rats were decapitated and the brain tissues were blotted dry, frozen in liquid nitrogen, and stored at 85C for further use.
Tissue homogenization and protein extraction
Frontal cortex of brain tissues were homogenized with the aid of Tissue RuptureÔ (Qiagen, Venlo, The Netherlands) homogenizer and homogenization medium consisting of 1.15% (w/v) KCl, 5 mM EDTA, 0.2 mM PMSF, and 0.2 mM DTT in 25 mM phosphate buffer at pH 7.4. Next, the homogenates were centrifuged at 1500 g for 10 min at 4C and the supernatants were aliquoted to perform enzyme assays and other biochemical analysis. Protein concentrations were determined according to the Lowry (1951) method. Determination of tissue oxidative stress biomarkers Measurements of total antioxidant status (TAS) and total oxidant status (TOS) was performed using a total antioxidant and oxidant status determination kits (Rel Assay Diagnostic, Gaziantep, Turkey) as described according to the protocols of the manufacturer. Measurements were carried out by ChemWell 2910 ELISA plate reader (Awareness Technology, Inc. Martin Hwy, Palm City, FL) and results were given as mmol Trolox equiv./g protein or lmol H2O2
equiv./g protein, respectively.
Reduced and oxidized glutathione (GSH and GSSH) levels were determined by HPLC chromatography having a fluor-escent detector (Ex: 385 nm; Em: 515 nm) using commercial kits (Chromsystems Diagnostics, Munich, Germany) accord-ing to the user manual. Results were given as mmol/g protein. Malonedialdehyde (MDA) levels were determined by HPLC chromatography having a fluorescent detector (Ex: 515 nm; Em: 553 nm) using commercial kits (Chromsystems Diagnostics, Munich, Germany) according to user manual. Results were given as mmol/g protein.
Determination of CAT, SOD-1, SOD-2, GPx, GST-Mu, and GST-Pi gene expressions with real time
polymerase chain reaction
Total RNAs were isolated from brain tissues (frontal cortex) using the RNeasy total RNA isolation kit (Qiagen, Venlo, The Netherlands) as described according to the protocol of the manufacturer. After isolation, the amount and the quality of total RNA were determined using spectrophotometry at 260/ 280 nm and agarose gel electrophoresis. One microgram of total RNA were reverse transcribed into cDNA using commercial first strand cDNA synthesis kit (Thermo Scientific, West Palm Beach, FL). Gene expressions were determined by mixing 1 ll cDNA, 5 ll SYBR Green Master mix (Roche FastStart Universal SYBR Green Master Mix, Roche, San Francisco, CA) and primer pairs (Table 1) at 0.5 mM concentrations in a final volume of 10 ml as described in detail elsewhere (Sadi et al., 2014). The relative expression of genes with respect to the internal control glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were calculated with the efficiency corrected advance relative quantification tool provided by the Light CyclerÕ480 SW 1.5.1 software (Roche, San Francisco, CA). Immunoblot analysis of CAT, SOD-1, SOD-2, GPx, and GST-Mu
For the determination of CAT, SOD-1, SOD-2, GPx, and GST-Mu protein contents, whole homogenates containing
10 mg (20 mg for GST-Mu, 50 mg for GPx) of proteins were separated by SDS-PAGE and electroblotted onto PVDF membranes (Towbin et al., 1992). Blotted membranes were then blocked with 5% (w/v) non-fat dried milk and incubated with primary antibodies for; CAT (Anti-CAT Rabbit IgG, Abcam-ab 16731, Abcam, Cambridge, MA, 1:6000), GPx (Anti-GPx Rabbit IgG, Santa Cruz Technology, Santa Cruz, CA, 1:100), SOD-1 (Anti-SOD-1 Sheep IgG, Calbiochem-574597, Calbiochem Inc., Billerica, MA, 1:5000), SOD-2 (Anti-SOD-2 Rabbit IgG, Santa Cruz- sc-30080, Santa Cruz Technology, Santa Cruz, CA, 1/100), GST-Mu (Anti-GST-Mu Rabbit IgG, Abcam-ab77925, Abcam, Cambridge, MA, 1:6000) for 2 h at room temperature. As an internal control, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) pro-teins were also labeled with anti-GAPDH Rabbit IgG (Santa Cruz-sc-25778, Santa Cruz Technology, Santa Cruz, CA, 1:2000) for the normalization. Horseradish peroxidase (HRP) conjugated secondary antibody (Goat Anti-rabbit-(or sheep for SOD-1) IgG-HRP conjugate; sc-2030 and sc-2770, Santa Cruz, USA, 1:10 000) was incubated for 1 h and then the blots were incubated in ClarityÔ Western ECL (Bio-Rad Laboratories, Hercules, CA) substrate solution. Images of the blots were obtained using the ChemiDocÔ MP Chemiluminescence detection system (Bio-Rad Laboratories, Hercules, CA) equipped with a CCD camera. The relative expression of proteins with respect to GAPDH was calculated using the ImageLab4.1 software (NIH, Bethesda, MD).
Determination of enzymatic activities
Total SOD activities were measured by following the inhibition of pyrogallol autoxidation spectrophotometrically (Marklund & Marklund, 1974). One unit of SOD activity was calculated as the amount of protein causing 50% inhibition of pyrogallol autoxidation. Total GST activities were monitored by the increase in the absorbance of 1-chloro-2,4-dinitroben-zene (CDNB)-reduced glutathione (GSH) adduct as described previously (Habig et al., 1974).
GPx activity measurements were carried out as described elsewhere (Paglia & Valentine, 1967). The method based on the measurement of degree of NADPH oxidation at 340 nm with glutathione reductase which uses oxidized glutathione as a substrate coming from GPx activities. One unit of GPx activity was described as the amount of NADPH consumed in 1 min by 1 mg protein containing cytosolic fraction.
The decomposition of hydrogen peroxide (H2O2) was
followed directly by the decrease in absorbance at 240 nm and the difference in absorbance per unit time was the measure of catalase activity (Aebi, 1984). One unit of catalase activity
was defined as the amount of substrate (mmol) consumed in 1 min by 1 mg total protein containing homogenate.
Statistical analysis
Data were expressed as mean ± standard error of means and compared for the differences by using the SPSS 15.0 statistical software (IBM Corporation, Armonk, NY). Statistical signifi-cance between groups was determined using one-way ANOVA with the appropriate post-hoc test (Tukey’s Honestly Significant Difference). Comparisons giving p values less than 0.05 were accepted as statistically significant.
Chemicals
trans-Resveratrol was purchased from Molekula (Gillingham, Dorset, UK) and STZ was obtained from Sigma (St. Louis, MO). Total RNA isolation kits were obtained from Qiagen (Venlo, The Netherlands) and reagents for cDNA synthesis were from Thermo Scientific (Burlington, Canada). SYBR Green I Master Mix was procured from Roche (Foster City, CA). Antibodies were supplied from Abcam (Cambridge, MA), and Santa Cruz (Santa Cruz, CA). Polyvinylidene fluoride (PVDF) membranes were acquired from Bio-Rad (Hercules, CA). All other chemicals used in this study were of the highest analytical grade available, and the buffers were prepared using sterile ultra-pure water.
Results
Effect of resveratrol on oxidative stress markers in diabetic rat brain tissues
In this study, the presence of oxidative stress in diabetic brain tissues was evidenced by the increase in MDA and TOS levels and decrease in TAS and GSH levels together with a reduction in GSH/GSSH ratio. Table 2 summarizes the changes in oxidative biomarkers of brain tissues with STZ and/or resveratrol treatment. Resveratrol partially normalized these oxidative biomarkers (except TAS) as given to the diabetic rats suggesting that it has strong antioxidant properties to increase the antioxidant potential in the brain tissues. Determination of gene expression levels of antioxidant enzymes
Gene expression of main antioxidant enzymes: superoxide dismutases (SOD-1 and SOD-2), catalase (CAT), glutathione peroxidase (GPx), and glutathione S-transferases (GST-Mu and GST-Pi) were determined by qRT-PCR for deep scanning of exact modulation mechanisms over those enzymes. Results demonstrated that the gene expression levels of main
Table 1. Primer sequences of CAT, GPx, SOD-1, SOD-2, GST-Mu, GST-Pi, and internal standard GAPDH used for the mRNA expression determination by qRT-PCR.
F-primer (50 !30) R-primer (50 !30) Product (bp)
CAT GCGAATGGAGAGGCAGTGTAC GAGTGACGTTGTCTTCATTAGCACTG 670 GPx CTCTCCGCGGTGGCACAGT CCACCACCGGGTCGGACATAC 290 SOD-1 GCAGAAGGCAAGCGGTGAAC TAGCAGGACAGCAGATGAGT 450 SOD-2 GCACATTAACGCGCAGATCA AGCCTCCAGCAACTCTCCTT 240 GST-Mu AGAAGCAGAAGCCAGAGTTC GGGGTGAGGTTGAGGAGATG 450 GST-Pi CCTCACCCTTTACCAATCTA TTCGTCCACTACTGTTTACC 462 GAPDH TGATGACATCAAGAAGGTGGTGAAG TCCTTGGAGGCCATGTGGGCCAT 360
antioxidant enzymes, CAT, SOD-1, GPx, GST-Mu, and GST-Pi, were induced significantly with diabetes in the brain tissues. CAT and SOD-1 gene expression levels were approximately 2-fold up-regulated (Figure 1A and C) while increase in GPx expression were 33% higher than control group (Figure 1B). Similarly, resveratrol application enhanced CAT and SOD-1 mRNA levels (approximately 50%) but it has not any significant effect on GPx and SOD-2 mRNA levels (Figure 1D). Resveratrol restored the SOD-1 and GPx levels as given to the diabetic group towards the control values. Effects of individual STZ and resveratrol application as well as their combination did not exert a change in SOD-2 gene expression. Results also suggested that similar to the main antioxidant enzymes, GST-Mu and GST-Pi were also up-regulated with diabetes (Figure 1E and F). Their expression levels were enhanced about 40% and these changes were statistically significant (p50.05). Even though resveratrol did not modify brain antioxidant enzyme expression levels as administered to control group, both GST-Mu and GST-Pi were normalized in diabetic group towards the control values.
Immunoblot analysis of CAT, SOD-1, SOD-2, GPx, and GST-Mu
Although gene expression data can suggest whether the protein is present or not and roughly what level to expect to see the protein level, in some cases, change in mRNA and protein levels do not correlate that well mainly due to the regulation control at different levels. Therefore, biochemical functions of proteins and enzymes might not be correlated to their associated mRNA levels. On the basis of this depiction, we also analyzed the protein levels of CAT, GPx, SOD-1, SOD-2, and GST-Mu and their concerted modulation in diabetic brain tissues with or without resveratrol. Immunoblot results were summarized in the representative blot images (Figure 2A). Densitometric analysis revealed that while brain CAT and GPx protein levels were not affected from diabetes significantly (Figure 2B and C), protein levels of SOD-1 and GST-Mu were also enhanced in diabetic brain tissues (Figure 2D and E) which was in parallel with the mRNA expression data. Among the other antioxidant enzymes, diabetes suppressed only mitochondrial SOD-2 which was evidenced from Figure 2F. Data also suggest that resveratrol increased the protein contents of CAT and GPx in control group but conversely suppressed the SOD-2 protein levels. As given to the diabetic animals, only the changes in GST-Mu were normalized with
resveratrol towards the control values. The other changes were statistically insignificant.
Effect of resveratrol on SOD-1, SOD-2, total GST, and GST-Mu activities in rat brain cortex tissues
The present study also revealed the effects of diabetes and resveratrol individually or in combination with antioxidant enzyme activities of brain tissues. Total superoxide dismutase activities responsible for the conversion of superoxide radical into hydrogen peroxide were enhanced (2.5-fold) in diabetic group (Figure 3A), the results of which were in parallel with the increase in both gene and protein expressions. While resveratrol did not have any significant effect on control group, it increased the total SOD activities further in diabetic brain tissues.
CAT, which is an enzyme functioning in the elimination of hydrogen peroxide, had also higher activities (p50.05) in STZ and resveratrol-treated groups either individually or in combination (Figure 3B). Similar with CAT, GPx activities were also augmented (2-fold) additively by diabetes and resveratrol administration (Figure 3C).
GST enzymes functionally catalyze the conjugation reac-tions between xenobiotics and reduced glutathione and additionally and more importantly neutralize peroxides and oxidatively modified molecules in the brain tissues. To evaluate whether diabetes and/or resveratrol affects such main phase II detoxification process, total GST activities were measured. The results indicated that while diabetes did not exert a significant effect on total GST activities, resveratrol was effective in up-regulation of activity.
Discussion
Brain is the main organ for the memory function and cognition. Memory formation is considered to stem from neural or synaptic plasticity whose continuance is of importance for the normal mental cognition (Greenwood & Parasuraman, 2010). Recent studies demonstrated a significant body of evidence for the detrimental effects of diabetes on brain functions. It has been shown to cause molecular, cellular, and functional alterations in the several sub-regions of the brain, which are associated with impairment in long term mental functions (Thomas et al., 2014). Some other studies also demonstrated whether or not decrease in mental cognition could be protected with some natural neuroprotectve agents such as morin (a flavonoid), rosmarinic acid, or resveratrol (El-Akabawy &
Table 2. Oxidative stress markers in diabetic rat brain tissues measured in control, diabetic, resveratrol supplemented control (C+RSV), and resveratrol supplemented diabetic (D+RSV) groups.
TAS mmol Trolox equiv./g protein TOS lmol H2O2 equiv./g protein MDA mmol/g protein GSH mmol/g protein GSSH mmol/g protein GSH/GSSH Control 0.207 ± 0.043 0.072 ± 0.021 0.636 ± 0.052 6.656 ± 0.540 24.670 ± 1.470 0.280 ± 0.038 Diabetes 0.113 ± 0.009a 0.088 ± 0.017a 0.876 ± 0.059a 4.527 ± 0.207a 31.670 ± 1.787 0.159 ± 0.011a C+RSV 0.130 ± 0.015a 0.082 ± 0.012 0.687 ± 0.132 5.438 ± 0.648 23.440 ± 3.018 0.237 ± 0.016 D + RSV 0.125 ± 0.032a 0.080 ± 0.023 0.699 ± 0.133 5.129 ± 0.398 20.090 ± 1.095b 0.279 ± 0.030 Data were expressed as mean ± standard error of mean (SEM).
aSignificance at p50.05 as compared with control groups.
bSignificance at p50.05 as compared with untreated diabetic groups.
El-Kholy, 2014; Jing et al., 2013; Mushtaq et al., 2014; Ola et al., 2014). However, the exact mechanisms of how diabetes could affect memory functions remains to be fully elucidated. In order to develop our understanding of the cognitive deficits, which could be apparent with uncontrolled diabetes, we produced STZ-induced diabetic rat models and evaluated the molecular changes in the brain antioxidant enzymes at gene, protein, and activity levels, with a particular focus on CAT, GPx, SOD-1, SOD-2, and GST enzymes. Another purpose of
the study was to determine the therapeutic efficiency of resveratrol which might be effective against oxidative stress and enhance the antioxidant systems to protect brain tissues from diabetes induced pathologies.
Several in vitro, experimental, and clinical studies have suggested that one of the reasons for diabetic neuronal degeneration is the oxidative stress generated by elevated glucose levels (El-Akabawy & El-Kholy, 2014; Mushtaq et al., 2014; Ola et al., 2014). Our results demonstrated a
Figure 1. Relative gene expression levels of CAT (A), GPx (B), SOD-1 (C), SOD-2 (D), GST-Mu (E), and GST-Pi (F) in control, diabetic, resveratrol supplemented control (C+RSV), and resveratrol supplemented diabetic (D+RSV) rat brain cortex. Data were normalized with respect to internal standard GAPDH. *Indicates that the means were significantly different (p50.05) compared with control groups. #Indicates that the means were significantly different (p50.05) compared with diabetic groups.
statistically significant increase in MDA and TOS levels and reduction in GSH/GSSH ratio together with TAS levels suggesting diabetes-promoted oxidative stress in STZ-induced diabetic rat brain tissues. Our findings also evidently suggest that resveratrol administration to the diabetic rats could be beneficial as it restored the levels of antioxidant
status and decreased the oxidative stress biomarkers. Protective effects of resveratrol against oxidative stress are in agreement with our previously published report conducted with the liver tissues of the same animals (Sadi et al., 2014). Thus, in addition to liver tissues, we suggest that resveratrol may also protect the brain tissues against the action of
Figure 2. Representative images for CAT, GPx, GST-Mu, SOD-1, and SOD-2 proteins (A) which were measured by Western blot analysis. Data were normalized with corresponding GAPDH. Effect of diabetes and resveratrol on CAT (B), GPx (C), GST-Mu (D), SOD-1 (E), and SOD-2 (F) protein levels are summarized. Each bar represents at least six rats. *Indicates that the means were significantly different (p50.05) compared with control groups. #Indicates that the means were significantly different (p50.05) compared with diabetic groups. C+RSV, resveratrol supplemented control group; D+RSV, resveratrol supplemented diabetic group.
oxidative stress which is mediated by diabetes-induced molecular changes.
Antioxidant enzymes have important roles in tissue protection against oxidative stress modifiers. In the present study, increase in the brain CAT, GPx, SOD-1, and GST gene expressions were also found to be elevated at protein and activity levels. Therefore, we can confer from these data that main antioxidant enzymes in the cytoplasm were regulated at the gene expression levels in diabetic rat brain tissues. Such a result could be denoted as an adaptation process towards the moderate increase in the oxidative stress biomarkers. Moreover, increase in GST-Mu levels could be a result of adaptive responses to oxidatively modified products and also to produce a response against peroxides, since GSTs are known to be effective towards various peroxides within a cell. One possible explanation for the increase in gene expression could be the induction of some transcription factors such as nuclear factor kappa B (NFjB) and nuclear factor erythroid 2-related factor (Nrf2) which are the key mediator of the redox homeostatic gene regulatory network, where under conditions of oxidative and electrophilic stress, their downstream signaling pathways could be activated to enhance the expression of multiple antioxidant and phase II enzymes (Marinho et al., 2014; Surh et al., 2008).
Another important aspect to be discussed in this study is that regulation mechanism of antioxidant enzymes is different in brain and liver tissues in such a way that brain antioxidant enzymes were up-regulated by a mild increase of oxidative stress in diabetes, while the main hepatic antioxidant enzymes were found to be suppressed significantly (Sadi et al., 2008, 2014). Such an alteration could be due to extensive oxidative conditions provided by long term hyperglycemia which leads antioxidant enzymes to be silenced in the liver tissues. Adaptive induction of brain antioxidant enzymes in diabetes pointed out that oxidative stress in brain tissue proceeds milder than that of liver tissues to stimulate antioxidant responses.
Mitochondrial isoform of superoxide dismutase (SOD-2), which makes up the 10% of total SOD activity in the cells, was not altered significantly in diabetic brain tissues at gene expression levels. However, unlike mRNA levels, protein expression was suppressed which could be due to very high levels of activity in electron transport chain under diabetic conditions. Such a proposed condition might lead to over-production of superoxide radicals in the mitochondria which in turn suppress the enzymes responsible for the removal of superoxide ions.
trans-Resveratrol (3,5,40-trihydroxystilbene), a well-known polyphenol, is found in various plants as a biologically active
Figure 3. Summary of the changes in total SOD (A), CAT (B), GPx (C), and total GST (D) activities. The results are expressed as mean ± SEM. Each bar represents at least nine rats. *Indicates that the means were significantly different (p50.05) compared with control groups. #Indicates that the means were significantly different (p50.05) compared with diabetic groups. C+RSV, resveratrol supplemented control group; D+RSV, resveratrol supplemented diabetic group.
substance. Recently, resveratrol has become increasingly attractive as a therapeutic agent due to its potential for the fortification of cognitive functions in diabetes (Thomas et al., 2014). However, the mechanisms underlying the beneficial effects of resveratrol have not been completely elucidated. In order to explore the potential of resveratrol supplementation to normalize diabetes-related changes in brain cortex tissues, several lines of experiments were also performed on resveratrol supplemented control and diabetic groups. The data depicts that diabetes-induced GPx, SOD-1 and GST (Mu and Pi) gene expression levels were normalized with resveratrol treatment. Reversal of the diabetes associated changes in the brain tissues reflects the reduction of oxidative conditions by resveratrol and decrease in need for the activation of antioxidant defense systems. Antioxidant defense supporting properties of resveratrol took place at gene expression levels of CAT and SOD-1, protein expression levels of CAT and GPx, and activity levels of CAT, GPx, and SOD enzymes in rat brain tissues.
Conclusion
Our data point out that STZ-induced diabetes provokes oxidative damage and imbalance between antioxidant enzymes at gene, protein, and activity levels, which might contribute the molecular mechanisms associated with oxidative modifica-tions in brain tissues. The findings of the present study also revealed that resveratrol may confer beneficial effects on memory and cognitive functions through its influences on brain antioxidant defense. Our data are consistent with the large body of literature showing beneficial health effects of resveratrol for therapeutic intervention of diabetes-induced oxidative modifi-cations and thereby the promising results suggests potential therapeutic targets and pathways for further evaluation. Declaration of interest
The authors report that they have no conflicts of interest. This study was supported by grants from TUBITAK Research Fund (112T159) and Karamanoglu Mehmetbey University (BAP-08-YL-13).
References
Aebi H. (1984). Catalase in vitro. In: Packer L, ed. Methods in Enzymology, vol. 105. San Diego (CA): Academic Press Inc., 121–6. Ates O, Cayli SR, Yucel N, et al. (2007) Central nervous system protection by resveratrol in streptozotocin-induced diabetic rats. J Clin Neurosci 14:256–60.
Ceretta LB, Re´us GZ, Abelaira HM, et al. (2012). Increased oxidative stress and imbalance in antioxidant enzymes in the brains of alloxan-induced diabetic rats. Exp Diabetes Res 2012:302682.
El-Akabawy G, El-Kholy W. (2014). Neuroprotective effect of ginger in the brain of streptozotocin-induced diabetic rats. Ann Anat 196: 119–28.
Greenwood PM, Parasuraman R. (2010). Neuronal and cognitive plasticity: A neurocognitive framework for ameliorating cognitive aging. Front Aging Neurosci 2:1–14.
Habig WH, Pabst MJ, Jakoby WB. (1974). Glutathione S-transferases. The first enzymatic step in mercapturic acid formation. J Biol Chem 249:7130–9.
Jing YH, Chen KH, Kuo PC, et al. (2013). Neurodegeneration in streptozotocin-induced diabetic rats is attenuated by treatment with resveratrol. Neuroendocrinology 98:116–27.
Lowry O, Roserbrough N, Farr A, et al. (1951). Protein measurement with Folin phenol reagent. J Biol Chem 193:265–75.
Marinho HS, Real C, Cyrne L, et al. (2014). Hydrogen peroxide sensing, signaling and regulation of transcription factors. Redox Biol 2:535–62. Marklund S, Marklund G. (1974). Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur J Biochem 47:469–74.
Marques FZ, Markus MA, Morris BJ. (2009). Resveratrol: Cellular actions of a potent natural chemical that confers a diversity of health benefits. Int J Biochem Cell Biol 41:2125–8.
Mushtaq N, Schmatz R, Pereira LB, et al. (2014). Rosmarinic acid prevents lipid peroxidation and increase in acetylcholinesterase activity in brain of streptozotocin-induced diabetic rats. Cell Biochem Funct 32:287–93.
Ola MS, Aleisa AM, Al-Rejaie SS, et al. (2014). Flavonoid, morin inhibits oxidative stress, inflammation and enhances neurotrophic support in the brain of streptozotocin-induced diabetic rats. Neurol Sci 35:1003–8.
Paglia D, Valentine W. (1967). Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase. J Lab Clin Med 70:158–69.
Pandey KB. (2009). Plant polyphenols as dietary antioxidants in human health and disease. Oxid Med Cell Longev 2:270–8.
Prabhakar O. (2013). Cerebroprotective effect of resveratrol through antioxidant and anti-inflammatory effects in diabetic rats. Arch Pharmacol 386:705–10.
Sadi G, Bozan D, Yildiz HB. (2014). Redox regulation of antioxidant enzymes: Post-translational modulation of catalase and glutathione peroxidase activity by resveratrol in diabetic rat liver. Mol Cell Biochem 393:111–22.
Sadi G, Yilmaz O, Gu¨ray T. (2008). Effect of vitamin C and lipoic acid on streptozotocin-induced diabetes gene expression: mRNA and protein expressions of Cu-Zn SOD and catalase. Mol Cell Biochem 309:109–16.
Skov V, Knudsen S, Olesen M, et al. (2012). Global gene expression profiling displays a network of dysregulated genes in non-athero-sclerotic arterial tissue from patients with type 2 diabetes. Cardiovasc Diabetol 11:15.
Surh Y-J, Kundu JK, Na H-K. (2008). Nrf2 as a master redox switch in turning on the cellular signaling involved in the induction of cytoprotective genes by some chemopreventive phytochemicals. Planta Med 74:1526–39.
Szkudelska K, Szkudelski T. (2010). Resveratrol, obesity and diabetes. Eur J Pharmacol 635:1–8.
Szkudelski T, Szkudelska K (2011). Anti-diabetic effects of resveratrol. Ann NY Acad Sci 1215:34–9.
Thirunavukkarasu M, Penumathsa SV, Koneru S, et al. (2007). Resveratrol alleviates cardiac dysfunction in streptozotocin-induced diabetes: Role of nitric oxide, thioredoxin, and heme oxygenase. Free Radic Biol Med 43:720–9.
Thomas J, Garg ML, Smith DW. (2013). Altered expression of histone and synaptic plasticity associated genes in the hippocam-pus of streptozotocin-induced diabetic mice. Metab Brain Dis 28: 613–18.
Thomas J, Garg ML, Smith DW. (2014). Dietary resveratrol supple-mentation normalizes gene expression in the hippocampus of streptozotocin-induced diabetic C57Bl/6 mice. J Nutr Biochem 25: 313–18.
Towbin H, Staehelin T, Gordon J. (1992). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications. Biotechnology 24:145–9.