• Sonuç bulunamadı

Molecular Survey of Babesia microti (Aconoidasida: Piroplasmida) in Wild Rodents in Turkey

N/A
N/A
Protected

Academic year: 2021

Share "Molecular Survey of Babesia microti (Aconoidasida: Piroplasmida) in Wild Rodents in Turkey"

Copied!
5
0
0

Yükleniyor.... (view fulltext now)

Tam metin

(1)

1605 © Crown copyright 2019.

Molecular Biology/Genomics

Molecular Survey of Babesia microti (Aconoidasida:

Piroplasmida) in Wild Rodents in Turkey

Selma Usluca,

1,9,

Bekir  Celebi,

2

Djursun Karasartova,

3

A. Semra Gureser

3

,

Ferhat Matur,

4

M. Ali  Oktem,

5

Mustafa Sozen,

6

, Ahmet  Karatas,

7

Cahit Babur,

1

Kosta Y.  Mumcuoglu,

8

and Aysegul  Taylan Ozkan

3,

1General Directorate of Public Health, Microbiology Reference Laboratories and Biological Products Department, Ankara,

Turkey, 2General Directorate of Public Health Department of Zoonotic and Vectorial Diseases, Ankara, Turkey, 3Department

of Microbiology, Hitit University, Faculty of Medicine, Corum, Turkey, 4Biology Department, Dokuz Eylul University, Faculty of

Science, Izmir, Turkey, 5Department of Microbiology and Clinical Microbiology, Dokuz Eylul University, Faculty of Medicine, Izmir,

Turkey, 6Biology Department, Zonguldak Bulent Ecevit University, Faculty of Science, Zonguldak, Turkey, 7Biology Department,

Nigde Omer Halisdemir University, Faculty of Science, Nigde, Turkey, 8Department of Microbiology and Molecular Genetics,

Parasitology Unit, The Hebrew University – Hadassah Medical School, Jerusalem, Israel, and 9Corresponding author, e-mail: [email protected]

Subject Editor: Janet Foley

Received 14 March 2019; Editorial decision 3 May 2019

Abstract

Babesia microti (Aconoidasida: Piroplasmida) (Franca, 1910)  is an important tick-borne zoonotic parasite

with rodents serving as reservoir hosts. In the present study, 536 rodents were captured from Burdur, Bartin, Giresun, and Yozgat provinces of Turkey between the years 2010 and 2012, and blood samples were examined for the presence of Babesia spp. using conventional PCR which targeted the 18S rRNA gene. The sequence analysis of PCR amplicons was tested for B.  microti as well as for Hepatozoon spp., and Sarcocystis spp. Overall, 5.8% of the rodents were positive for B. microti: 41% in Myodes glareolus, 7.7% in Chionomys roberti, and 2% in Apodemus spp., whereas no Babesia DNA was detected in Mus macedonicus and Microtus spp. Six rodents were positive for Hepatozoon spp. and one rodent was positive for Sarcocystis spp. Overall, 14.9 and 4.5% of rodents captured from Bartin and Giresun provinces, respectively, were PCR positive for B. microti, whereas none of rodents captured in Burdur and Yozgat were positive for Babesia spp. The sequence data of

B. microti from rodents revealed that all sequences belonged to the zoonotic genotype. Sequences of B. microti

obtained from rodents of the Bartin province were genotypically closer to European isolates, whereas those obtained from rodents of the Giresun province were closer to Russian and Mongolian isolates.

Key words: rodent, Babesia microti, Hepatozoon spp., Sarcocystis spp., Turkey

Tick-borne diseases are a growing health problem worldwide. Recent epidemics caused by tick-borne diseases, the abundance of tick species, and the existence of appropriate habitats altogether increase the importance of epidemiological studies on tick-borne diseases (Gratz 2006).

Babesia species are intraerythrocytic protozoan parasites which

are usually transmitted by ticks of the genus Ixodes. Babesia microti is a zoonotic parasite for which rodents serve as reservoirs and causes ba-besiosis in humans (Karbowiak 2004; Gray 2004, 2006; Yabsley and Shock 2013; Hamšíková et al. 2016a; Bielicka et al. 2017). The clin-ical manifestation of human babesiosis may range from asymptomatic infection to moderate malaria-like symptoms and life-threatening ill-ness in the elderly and immunocompromised individuals (Gray 2004,

2006; Poyraz and Gunes 2010; Yabsley and Shock 2013).

Microscopic, serological, and molecular methods are used for diagnosis of babesiosis in humans and animals. The identification, characterization, and molecular, epidemiological characteristics of

Babesia species is usually done by PCR and DNA sequence analysis

(Yabsley and Shock 2013).

In Turkey, seroepidemiological studies showed the presence of

B.  microti in humans living in the Black Sea region (Poyraz and Gunes 2010, Taylan Ozkan et al. 2009), whereas PCR studies in ticks showed the presence of B. microti in Ixodes ricinus and Hyalomma

marginatum collected from sheep and goats in Black Sea region and

humans in Central Anatolian region, respectively (Aydin et al. 2015,

Karasartova et al. 2018).

Ixodes ricinus, which is one of the main vectors of B. microti,

prefer temperate, rainfall, and forested regions as habitats doi: 10.1093/jme/tjz084

Advance Access Publication Date: 30 May 2019 Research

(2)

(Otranto 2017, Wikel 2018). In Turkey, this species shows the highest density in the Black Sea region (Otranto 2017). We hypothesized that rodents in provinces such Bartin and Giresun which are situated in the coastal region of the Black Sea would show higher infestation rate for B.  microti than the provinces Burdur and Yozgat which are located in regions with terrestrial climatic conditions. The aim of this study was to investigate the presence of B. microti by molecular methods in rodents captured in two humid and two dry regions of Turkey.

Materials and Methods

Study Setting

The study was carried out in Burdur, Yozgat, Bartin, and Giresun provinces of Turkey (Fig. 1). Burdur is located in the Mediterranean biome and has a continental climate. Yozgat has a continental cli-mate and has the typical vegetation of the Irano-turanian subregion. Bartin and Giresun are located in the boreal (European-Siberian) belt. Forests are composed of coniferous trees such as spruce and fir at high altitudes and deciduous (broad-leaved) trees at lower altitudes. Bartin is situated in the Western Black Sea Region of the country and has a 59 km coastline on the north, bordering the Black Sea. In terms of biodiversity, the forests of Bartin are among the richest in Turkey. The amount of rainfall in this region is more than twice as the mean rainfall of Turkey. Giresun is located in the Eastern Black Sea Region of Turkey, it is coasted by the Black Sea on the north, and it is the second rainiest province of Turkey.

Rodents

Between 2010 and 2012, 536 rodents were captured from the ag-ricultural and forest areas of the four provinces using Sherman live traps and identified according to standard taxonomic keys (Nagorsen and Peterson 1980, Budak et al. 1997). Blood was taken by cardiac puncture, frozen in liquid nitrogen, and transferred to the laboratory, where they were stored at −80°C until analysis. Permission to con-duct this study was obtained from the Animal Ethics Committee of the Refik Saydam Hygiene Center (06.04.2010/11/27).

DNA Extraction and PCR

DNA extraction from the blood samples was performed using the Blood Extraction Kit (Qiagen, Hilden, Germany) according to the

manufacturer’s instructions. For the detection of Babesia species, conventional PCR amplification of the 18S rRNA gene region was performed using the BJ1 GTCTTGTAATTGGAATGATGG and BN2 TAGTTTATGGTTAGGACTACG primers. The conventional PCR method described by Casati et  al. (2006) was used to detect

Babesia species. For each PCR procedure, double positive and

neg-ative controls were used. PCR products were analyzed by 1.5% agarose gel electrophoresis, and samples with 516 bp amplification were considered positive. Positive amplification products were used for sequence analysis.

Sequence and Phylogenetic Analysis

PCR amplification products were purified for sequence analysis using the ExoSAP-IT PCR Product Cleanup Reagent kit (Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. Purified PCR products were sent to Macrogen Europe Laboratories (Amsterdam, the Netherlands) for Sanger Sequencing. ABI 3730XL DNA analyzer (Applied Biosystems, Foster City, CA) and BigDye Terminator v3.1 Cycle sequencing kit (Applied Biosystems, Foster City, CA) were used for DNA sequencing. The DNA sequences were compared with the data stored in the GenBank database with the Basic Local Alignment Search Tool software (Blast version 2.0). The sequences were aligned using ClustalW, MegAlign program in MEGA 5.1 software. The Neighbor Joining method was used to create phylogenetic tree, and Bootstrap method and Tamura 3-pa-rameter model were used to reveal the reliability of phylogeny. Sequence data were recorded to GenBank and accession numbers were obtained.

Results

The rodent species captured were Myodes glareolus (n  =  54),

Apodemus flavicollis (n  =  135), Apodemus sylvaticus (n  =  24), Apodemus witherbyi (n  =  93), Apodemus uralensis (n  =  56), Apodemus mystacinus (n  =  74), Chionomys roberti (n  =  13), Microtus subterraneus (n = 4), Microtus guentheri (n = 26), and Mus macedonicus (n = 57). The distribution of rodents according to the

province they were captured is presented in Table 1.

The examination of the 536 rodent blood samples by PCR amplification of the 18S rRNA gene region revealed a 516  bp of amplification product, which was observed in 46 samples using gel electrophoresis. After the sequencing of the product, only 38

Fig. 1. Provinces of Turkey from which rodents were collected. Locations where Babesia microti positive rodents were found are shown with a dark asterix.

(3)

samples could be evaluated, 31 of which were positive for B. microti. Accordingly, 5.8% of the rodents were positive for B. microti. The ro-dent with the highest PCR positivity for B. microti was M. glareolus (40.7%), followed by C. robertii (7.7%), and Apodemus spp. (2%), whereas none of the M. macedonicus and M. subterraneus specimens were positive. PCR positivity for B. microti was detected in 14.9 and 4.5% of rodents captured from Bartin and Giresun provinces, respec-tively (Table 1). None of the blood samples collected from rodents captured in Burdur and Yozgat were positive for Babesia spp.

Sequence data were registered to GenBank and accession num-bers were obtained. For B. microti 18S rRNA gene region sequences accession numbers were obtained from MH523067 to MH523097. Out of the 31 B. microti sequences obtained in our study, 23 showed a 100% similarity with B. microti accession number EF413181 (Jena strain/Germany), whereas sequences of eight other samples showed a 99% similarity. The sequences of 23 samples showed a 96% simi-larity with B. microti accession number AB017177 (Munich strain/ Germany), whereas the sequences of the remaining eight samples showed a 95% similarity with this strain.

According to the phylogenetic tree, all B.  microti sequences which were determined in this study belonged to the zoonotic geno-type (Accession number EF413181 B. microti Jena strain/Germany). None of the B.  microti sequences were involved the nonzoonotic genotype (Accession number AB017177 Munich strain/Germany;

Fig. 2).

Sequences of B.  microti obtained from rodents of the Bartin province were genotypically closer to European isolates, whereas the ones obtained from rodents of the Giresun province were closer to Russian and Mongolian isolates (Fig. 2).

The BJ1 and BN2 primers used to amplify the 18S rRNA gene in Babesia spp. are also able to amplify the 18S rRNA gene of some other protozoa. In this study, Hepatozoon spp. were detected in 1% of the rodents. The DNA sequences of the two Hepatozoon spp.

identified in M. glareolus showed a 99% similarity to the sequence of

Hepatozoon spp. reported in European M. glareolus (Accession

num-bers AY600625, KU597249, and JX644997). Four DNA sequences of Hepatozoon spp. found in the forest mouse genus Apodemus (A.  uralensis, A.  mystacinus) showed a 99% similarity to the se-quence of Hepatozoon spp. reported in snakes (Accession number EF175822). Sarcocystis spp. was detected in one A. sylvaticus and showed a 99% similarity with sequence of Sarcocystis spp. (Sorex

araneus, Accession number JQ886022).

Discussion

Babesia microti is one of the rodent-borne parasitic zoonotic agents

that cause babesiosis in humans. In Turkey, a seroepidemiological study was conducted in individuals living in rural areas of Sinop (Black Sea region) and working in animal husbandary. Overall 6.23% of 273 examined were positive for B.  microti IgG by the indirect fluorescent antibody test (IFAT; Poyraz and Gunes 2010). In a second study done in province of Amasya (also Black Sea re-gion), 0.86% of 116 individuals with a history of tick infestation were seropositive for B. microti (Taylan Ozkan et al. 2009). Aydin et  al. (2015) showed the presence of B.  microti in Ixodes ricinus collected from sheeps and goats located in the Black Sea region. In a study conducted in the Corum Province (located between the Black Sea and Central Anatolian regions), 0.93% of the Hyalomma

marginatum ticks collected from humans were infected with B. microti (Karasartova et al. 2018).

In the present study, the highest B.  microti positivity (14.9%) was detected in rodent collected in Bartin province which is located in the same geographic and climatic region as Sinop. This region receives the highest amount of rainfall in Turkey and is the richest in terms of biodiversity. These conditions are optimal for I. ricinus, the main vector of B. microti.

Table 1.  Distribution of captured rodents according to province and B. microti positivity

Rodent species Babesia microti positivity

Bartin (n = 147) positive/total (%) Giresun (n = 196) positive/total (%) Yozgat (n = 91) positive/total (%) Burdur (n = 102) positive/total (%) Total (n = 536) positive/total (%) Myodes glareolus (n = 54)

The bank wole

20/41 (48.7) 2/13 (15.4) – – 22/54 (40.7)

Apodemus flavicollis (n = 135) Yellow-necked field mouse

1/43 (2.3) 2/66 (3.0) 0/22 (0.0) 0/4 (0.0) 3/135 (2.2)

Apodemus witherbyi (n = 93) Steppe field mouse

0/38 (0.0) 0/15 (0.0) 0/20 (0.0) 0/20 (0.0) 0/93 (0.0)

Apodemus uralensis (n = 56) Herb field mouse

1/17 (5.8) 1/39 (2.5) – – 2/56 (3.5)

Apodemus mystacinus (n = 74) Eastern broad-toothed field

mouse

0/8 (0.0) 1/22 (4.5) 0/30 (0.0) 0/14 (0.0) 1/74 (1.3)

Apodemus sylvaticus (n = 24) Long-tailed field mouse

– 2/24 (8.3) – – 2/24 (8.3)

Chionomys robertii (n = 13) Roberts snow vole

– 1/13 (7.7) – – 1/13 (7.7)

Pitymys subterraneus (n = 4) European pine vole

– 0/4 (0.0) – – 0/4 (0.0) Mus macedonicus (n = 57) Macedonian mouse – – – 0/57 (0.0) 0/57 (0.0) Microtus guentheri (n = 26) Günthers vole – – 0/19 (0) 0/7 (0.0) 0/26 (0) Total (n = 536) 22/147 (14.9) 9/196 (4.5) 0/91 (0.0) 0/102 (0.0) 31/536 (5.8)

(4)

In Turkey, I. ricinus is common in the Western and Eastern Black Sea regions, whereas it has been reported rarely in some remaining local areas of Marmara and Aegean region (Otranto et  al. 2017). The high PCR positivity among rodents and the optimal conditions for I. ricinus may pose an increased risk of B. microti infections in humans. The fact that the PCR positivity for B. microti in rodents was higher in Bartin (14.9%) and Giresun (4.5%) compared with

Yozgat and Burdur may be explained by the more humid climate of this provinces, providing a more suitable environment for I. ricinus than the continental climate of Yozgat and Burdur.

In Poland 41% and in Finland 40% of the rodents were PCR positive for B.  microti (Kallio et  al. 2014, Tołkacz et  al. 2017), whereas PCR positivity was lower in Slovakia (4.2%), England (5.8%), Croatia (3.3%), and Germany (2.1%; Bown et  al., 2008,

GQ856653 Babesia microti Ixodes ricinus - Belgium

EF413181 Babesia microti human isolate Jena/Germany (zoonotic) KC470048 Babesia microti Ixodes ricinus - Poland

JX627356 Babesia microti Ixodes ricinus - Germany KJ508857 Babesia microti Ixodes ricinus- Slovakia JQ711225 Babesia microti Ixodes ricinus -Belarus KX591647 Babesia microti Ixodes ricinus-Ukraine MH523081 Babesia microti BA70-Myodes glareolus MH523080 Babesia microti BA69-Myodes glareolus MH523079 Babesia microti BA65-Myodes glareolus MH523078 Babesia microti BA58-Myodes glareolus MH523089 Babesia microti BA47-Apodemus flavicollis MH523092 Babesia microti BA36-Apodemus uralensis MH523076 Babesia microti BA32-Myodes glareolus MH523075 Babesia microti BA31-Myodes glareolus MH523074 Babesia microti BA30-Myodes glareolus MH523073 Babesia microti BA29-Myodes glareolus MH523071 Babesia microti BA22-Myodes glareolus MH523070 Babesia microti BA21-Myodes glareolus MH523067 Babesia microti BA3-Myodes glareolus MH523068 Babesia microti BA10-Myodes glareolus MH523097 Babesia microti G30-Chionomys robertii MH523094 Babesia microti G48-Apodemus sylvaticus MH523093 Babesia microti G2011-17-Apodemus uralensis MH523096 Babesia microti G2011-45-Apodemus mystacinus MH523095 Babesia microti G2011-53-Apodemus sylvaticus MH523087 Babesia microti G2011-83-Myodes glareolus KU955528 Babesia microti Myodes rufocanus Russia LC005771 Babesia microti Ixodes persulcatus -Mongolia MF383493 Babesia microti isolate 251 H.marg/Corum Turkey

MH523090 Babesia microti G2011-4-Apodemus flavicollis MH523091 Babesia microti G2011-25-Apodemus flavicollis AB071177 Babesia microti Munich strain (unzoonotic) KC581934 Babesia microti clone Omsk-vole Russia AY943958 Babesia microti isolate Ubl-104 C. rutilus Russia

MF040154 Babesia vulpes Fox- Turkey AY452707 Babesia felis

AY150062 Babesia equi KU377437 Babesia divergens KY021188 Babesia canis 99 99 70 93 99 50 82 61 0.020

Fig. 2. Phylogenetic relationship between 516 bp of 18S rRNA sequences of B. microti detected in rodents from Turkey and previously described Babesia species data from GenBank. The phylogenetic tree was created with the Neighbor Joining method and the Bootstrap method Tamura 3 parameter model in the MEGA5 program. In the phylogenetic tree, the accession number between MH523067 and MH523097 is the B. microti sequence data in this study.

(5)

Obiegala et al. 2015, Hamšíková et al. 2016a, Bielicka et al. 2017). In our study, B. microti was detected in 5.8% of the rodents, which is lower than the northern European countries.

The main rodent reservoirs of B.  microti in European wildlife are Microtus spp., A. flavicollis, and M. glareolus (Duh et al. 2003,

Pawelczyk et  al. 2004, Bown et  al. 2008, Beck et  al., 2011, Bajer et al. 2014, Kallio et al. 2014, Tołkacz et al. 2017). In our study, as in the study of Kallio et al. (2014) and Beck et al. (2011), the highest PCR positivity for B. microti was found in M. glareolus (48.7% in Bartin and 15.4% in Giresun), making this species a possible reser-voir for B. microti in the region.

In a study conducted in Croatia, it was shown that the majority of the isolates have similarity with the zoonotic Jena/Germany strain, whereas some with the nonzoonotic Munich strain (Beck et al. 2011). In Slovakia, positive samples were identical to the zo-onotic B.  microti Jena/Germany strain, whereas in Finland there were identical to the nonzoonotic Munich strain (Kallio et al. 2014,

Hamšíková et  al. 2016a). Our phylogenetic tree showed that all

B. microti sequences belonged to the zoonotic genotype (Accession

number EF413181 B.  microti Jena/Germany). Sequences obtained from the Bartin province were genetically closer to European isolates, whereas sequences obtained from the Giresun province were closer to Russian and Mongolian isolates.

The BJ1 and BN2 primers used for the PCR of the 18S rRNA gene in Babesia spp. can also amplify the 18S rRNA gene of some other protozoa of the phylum Apicomplexa. In the present study, 1% of the rodents were positive for Hepatozoon spp., whereas a single rodent for Sarcocystis spp. PCR studies carried out in Slovakia and the Czech Republic reported that Hepatozoon spp. were detected in 0.06% of the Ixodes ticks and 4.45% of the rodents examined (Hamšíková et al. 2016b).

The increasing interactions between humans and the environ-ment, landscape and climatic changes, the abundance of host and vector species and changes in community structures altogether pro-mote the spread of tick-borne diseases such as babesiosis. To the best of our knowledge, this is the first study in our country which investigated the positivity of B.  microti, Hepatozoon spp. and

Sarcocystis spp. in rodents using molecular techniques.

Acknowledgments

In this study, rodent specimens obtained from “Hanta Virus Field Project” of Refik Saydam Hygiene Center between 2010 and 2012 were used.

References Cited

Aydin, M. F., M. Aktas, and N. Dumanli. 2015. Molecular identification of

Theileria and Babesia in ticks collected from sheep and goats in the Black

Sea region of Turkey. Parasitol. Res. 114: 65–69.

Bajer,  A.,  R. Welc-Falęciak,  M. Bednarska,  M. Alsarraf,  J. Behnke-Borowczyk, E. Siński, and J. M. Behnke. 2014. Long-term spatiotemporal stability and dynamic changes in the haemoparasite community of bank voles (Myodes glareolus) in NE Poland. Microb. Ecol. 68: 196–211. Beck, R., L. Vojta, S. Curković, V. Mrljak, J. Margaletić, and B. Habrun. 2011.

Molecular survey of Babesia microti in wild rodents in central Croatia. Vector Borne Zoonotic Dis. 11: 81–83.

Bielicka, W. R., A. Masny, and E. Golab. 2017. High-resolution melting PCR assay, applicable for diagnostics and screening studies, allowing detection and differentiation of several Babesia spp. infecting humans and animals. Parasitol. Res. 116: 2671–2681.

Bown, K. J., X. Lambin, G. R. Telford, N. H. Ogden, S. Telfer, Z. Woldehiwet, and R. J. Birtles. 2008. Relative importance of Ixodes ricinus and Ixodes

trianguliceps as vectors for Anaplasma phagocytophilum and Babesia microti in field vole (Microtus agrestis) populations. Appl. Environ.

Microbiol. 74: 7118–7125.

Budak, A., C. V. Tok, and A. Karataş. 1997. Mammaloji laboratuvar kılavuzu. Ege Üniversitesi Fen Fakültesi Yayınevi (Teksirler Serisi, No: 121), pp. 50 Izmir, Turkey.

Casati, S., H. Sager, L. Gern, and J. C. Piffaretti. 2006. Presence of potentially pathogenic Babesia sp. for human in Ixodes ricinus in Switzerland. Ann. Agric. Environ. Med. 13: 65–70.

Duh, D., M. Petrovec, T. Trilar, and T. Avsic-Zupanc. 2003. The molecular evi-dence of Babesia microti infection in small mammals collected in Slovenia. Parasitology. 126: 113–117.

Gratz, N. G. 2006. Vector and rodent borne diseases in Europe and North America. Cambridge University Press, Cambridge, UK.

Gray, J. S. 2004. Babesia sp.: emerging intracellular parasites in Europe. Pol. J. Microbiol. 53 (Suppl): 55–60.

Gray, J. S. 2006. Identity of the causal agents of human babesiosis in Europe. Int. J. Med. Microbiol. 296 (Suppl 40): 131–136.

Hamšíková, Z., Á. M. Kazimírov, D. Haruštiaková, L. Mahrikova, M. Slovak, L.  Berthova, E.  Kocianova, and L.  Schnittger. 2016a. Babesia spp. in ticks and wildlife in different habitat types of Slovakia. Parasites Vectors 9:292–306.

Hamšíková, Z., C. Silaghi, I. Rudolf, K. Venclíková, L. Mahríková, M. Slovák, J. Mendel, H. Blažejová, L. Berthová, E. Kocianová, et al. 2016b. Molecular detection and phylogenetic analysis of Hepatozoon spp. in questing Ixodes

ricinus ticks and rodents from Slovakia and Czech Republic. Parasitol.

Res. 115: 3897–3904.

Kallio,  E.  R.,  M. Begon,  R.  J. Birtles,  K.  J. Bown,  E. Koskela,  T. Mappes, and P. C. Watts. 2014. First report of Anaplasma phagocytophilum and

Babesia microti in rodents in Finland. Vector Borne Zoonotic Dis. 14:

389–393.

Karasartova, D., A. S. Gureser, T. Gokce, B. Celebi, D. Yapar, A. Keskin, S. Celik, Y. Ece, A. K. Erenler, S. Usluca, et al. 2018. Bacterial and protozoal pathogens found in ticks collected from humans in Corum province of Turkey. Plos Negl. Trop. Dis. 12: e0006395.

Karbowiak,  G. 2004. Zoonotic reservoir of Babesia microti in Poland. Pol. J. Microbiol. 53 (Suppl): 61–65.

Nagorsen, D. W., and R. L. Peterson. 1980. Mammal collectors’ Manual. Life Sciences Miscellaneous Publications, Royal Ontario Museum, pp. 79. Obiegala, A., M. Pfeffer, K. Pfister, C. Karnath, and C. Silaghi. 2015. Molecular

examinations of Babesia microti in rodents and rodent-attached ticks from urban and sylvatic habitats in Germany. Ticks Tick. Borne. Dis. 6: 445–449.

Otranto, D., F. Dantas-Torres, and M. M. Santos-Silva. 2017. Ixodes ricinus (Linnaeus, 1758), pp. 189–195. In P. A. Estrada, D. M. Andrei, N. P. Trevor (eds.), Ticks of Europe and North Africa a guide to species identification. Springer International Publishing, Cham, Switzerland.

Pawelczyk,  A.,  A. Bajer,  J.  M. Behnke,  F.  S. Gilbert, and E.  Sinski. 2004. Factors affecting the component community structure of haemoparasites in common voles (Microtus arvalis) from the Mazury Lake District region of Poland. Parasitol. Res. 92: 270–284.

Poyraz, O., and T. Güneş. 2010. Seroprevalence of Babesia microti in humans living in rural areas of the Sinop Region (in Turkish). Turkiye Parazitol. Derg. 34: 81–85.

Taylan  Ozkan,  A., M.  Mungan, Y.  Uyar, D.  Yagci  Caglayik, C.  Babur, and M. Ertek. 2009. Investigation of Babesia microti by IFAT in CCHF nega-tive cases’ sera from Turkey. Proceedings of the 5th International Congress of Vector Ecology, 11–16 October, 2009, Antalya, Turkey.

Tołkacz,  K.,  M. Bednarska,  M. Alsarraf,  D. Dwużnik,  M. Grzybek,  R. Welc-Falęciak, J. M. Behnke, and A. Bajer. 2017. Prevalence, genetic identity and vertical transmission of Babesia microti in three naturally infected species of vole, Microtus spp. (Cricetidae). Parasit. Vectors. 10: 66.

Wikel, S. K. 2018. Ticks and tick-borne infections: complex ecology, agents, and host interactions. Vet Sci. 5(60): 1–22

Yabsley, M. J., and B. C. Shock. 2013. Natural history of Zoonotic Babesia: role of wildlife reservoirs. Int. J. Parasitol. Parasites Wildl. 2: 18–31.

Referanslar

Benzer Belgeler

Cumhuriyet baloları, yılbaşı baloları, maskeli balolar, hayır amaçlı balolar (şefkat sofraları) ve ev partileri bu romanlarda yer alan danslı ve içkili

This study shows that scientific awareness towards sustainability, sustainable development and ecotourism has gained more importance that the number of qualified

It is concluded that the change in ignition delay associated with the inlet charge dilution had only minor effects on engine combustion and emissions while the

As a result of this study conducted to evaluate correct diagnosis of (by comparing with hospital emergency service) and intervention to stroke cases by paramedics

E.coli cell counts in 84 meat samples have been found higher than Turkish Food Codex limits and 42 of 84 have been observed that were collected from public bazaars. S.aureus counts

A comparative analysis was made firstly on South Ionia and Caria’s provenances and other finds which had similar scenes and depictions of the Archaic Period

Normal öğretim süresi dört yıl ve bir yıllık İngilizce hazırlık sınıfı ile birlikte beş yıl olan orta dereceli tekniköğretim kurumla­ ndır. öğretim

Ayr›ca futbol, Asla Sadece Futbol De- ¤ildir adl› kitab›nda Simon Kuper’in de belirtti¤i gibi siyasilerin halk› yönlendir- mek için kulland›klar› bir araç (Porte-